ID: 1086888082

View in Genome Browser
Species Human (GRCh38)
Location 11:92226072-92226094
Sequence CACACACACTGGCCTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888082_1086888097 14 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888082_1086888098 17 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888098 11:92226112-92226134 GCTGAGGGGCGCTGGCGGGGAGG No data
1086888082_1086888100 29 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888082_1086888099 26 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888099 11:92226121-92226143 CGCTGGCGGGGAGGCAGTAGAGG No data
1086888082_1086888096 13 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888096 11:92226108-92226130 GGGGGCTGAGGGGCGCTGGCGGG No data
1086888082_1086888093 3 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888082_1086888091 1 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888091 11:92226096-92226118 AGGGCAAGTGTAGGGGGCTGAGG No data
1086888082_1086888094 9 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888094 11:92226104-92226126 TGTAGGGGGCTGAGGGGCGCTGG No data
1086888082_1086888089 -6 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888089 11:92226089-92226111 TGTGTGCAGGGCAAGTGTAGGGG No data
1086888082_1086888087 -8 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888082_1086888092 2 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888092 11:92226097-92226119 GGGCAAGTGTAGGGGGCTGAGGG No data
1086888082_1086888090 -5 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888090 11:92226090-92226112 GTGTGCAGGGCAAGTGTAGGGGG No data
1086888082_1086888095 12 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888095 11:92226107-92226129 AGGGGGCTGAGGGGCGCTGGCGG No data
1086888082_1086888088 -7 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888088 11:92226088-92226110 GTGTGTGCAGGGCAAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888082 Original CRISPR CACACACACTGGCCTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr