ID: 1086888083

View in Genome Browser
Species Human (GRCh38)
Location 11:92226073-92226095
Sequence GCACACACACTGGCCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888083_1086888098 16 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888098 11:92226112-92226134 GCTGAGGGGCGCTGGCGGGGAGG No data
1086888083_1086888091 0 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888091 11:92226096-92226118 AGGGCAAGTGTAGGGGGCTGAGG No data
1086888083_1086888093 2 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888083_1086888096 12 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888096 11:92226108-92226130 GGGGGCTGAGGGGCGCTGGCGGG No data
1086888083_1086888097 13 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888083_1086888099 25 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888099 11:92226121-92226143 CGCTGGCGGGGAGGCAGTAGAGG No data
1086888083_1086888088 -8 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888088 11:92226088-92226110 GTGTGTGCAGGGCAAGTGTAGGG No data
1086888083_1086888100 28 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888083_1086888092 1 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888092 11:92226097-92226119 GGGCAAGTGTAGGGGGCTGAGGG No data
1086888083_1086888095 11 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888095 11:92226107-92226129 AGGGGGCTGAGGGGCGCTGGCGG No data
1086888083_1086888087 -9 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888083_1086888089 -7 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888089 11:92226089-92226111 TGTGTGCAGGGCAAGTGTAGGGG No data
1086888083_1086888090 -6 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888090 11:92226090-92226112 GTGTGCAGGGCAAGTGTAGGGGG No data
1086888083_1086888094 8 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888094 11:92226104-92226126 TGTAGGGGGCTGAGGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888083 Original CRISPR GCACACACACTGGCCTGTAG AGG (reversed) Intergenic