ID: 1086888086

View in Genome Browser
Species Human (GRCh38)
Location 11:92226083-92226105
Sequence CACTTGCCCTGCACACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888086_1086888091 -10 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888091 11:92226096-92226118 AGGGCAAGTGTAGGGGGCTGAGG No data
1086888086_1086888097 3 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888086_1086888100 18 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888086_1086888093 -8 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888086_1086888094 -2 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888094 11:92226104-92226126 TGTAGGGGGCTGAGGGGCGCTGG No data
1086888086_1086888098 6 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888098 11:92226112-92226134 GCTGAGGGGCGCTGGCGGGGAGG No data
1086888086_1086888092 -9 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888092 11:92226097-92226119 GGGCAAGTGTAGGGGGCTGAGGG No data
1086888086_1086888099 15 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888099 11:92226121-92226143 CGCTGGCGGGGAGGCAGTAGAGG No data
1086888086_1086888096 2 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888096 11:92226108-92226130 GGGGGCTGAGGGGCGCTGGCGGG No data
1086888086_1086888095 1 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888095 11:92226107-92226129 AGGGGGCTGAGGGGCGCTGGCGG No data
1086888086_1086888101 23 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888101 11:92226129-92226151 GGGAGGCAGTAGAGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888086 Original CRISPR CACTTGCCCTGCACACACAC TGG (reversed) Intergenic