ID: 1086888087

View in Genome Browser
Species Human (GRCh38)
Location 11:92226087-92226109
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888077_1086888087 19 Left 1086888077 11:92226045-92226067 CCACTCCCGGGCGGTTCGGGACG No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888083_1086888087 -9 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888082_1086888087 -8 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888079_1086888087 13 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888081_1086888087 -7 Left 1086888081 11:92226071-92226093 CCCCTCTACAGGCCAGTGTGTGT No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888076_1086888087 20 Left 1086888076 11:92226044-92226066 CCCACTCCCGGGCGGTTCGGGAC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888075_1086888087 21 Left 1086888075 11:92226043-92226065 CCCCACTCCCGGGCGGTTCGGGA No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data
1086888078_1086888087 14 Left 1086888078 11:92226050-92226072 CCCGGGCGGTTCGGGACGAATCC No data
Right 1086888087 11:92226087-92226109 TGTGTGTGCAGGGCAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888087 Original CRISPR TGTGTGTGCAGGGCAAGTGT AGG Intergenic
No off target data available for this crispr