ID: 1086888093

View in Genome Browser
Species Human (GRCh38)
Location 11:92226098-92226120
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888082_1086888093 3 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888078_1086888093 25 Left 1086888078 11:92226050-92226072 CCCGGGCGGTTCGGGACGAATCC No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888083_1086888093 2 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888079_1086888093 24 Left 1086888079 11:92226051-92226073 CCGGGCGGTTCGGGACGAATCCC No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888081_1086888093 4 Left 1086888081 11:92226071-92226093 CCCCTCTACAGGCCAGTGTGTGT No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888077_1086888093 30 Left 1086888077 11:92226045-92226067 CCACTCCCGGGCGGTTCGGGACG No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data
1086888086_1086888093 -8 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888093 11:92226098-92226120 GGCAAGTGTAGGGGGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888093 Original CRISPR GGCAAGTGTAGGGGGCTGAG GGG Intergenic
No off target data available for this crispr