ID: 1086888097

View in Genome Browser
Species Human (GRCh38)
Location 11:92226109-92226131
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888086_1086888097 3 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888081_1086888097 15 Left 1086888081 11:92226071-92226093 CCCCTCTACAGGCCAGTGTGTGT No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888083_1086888097 13 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data
1086888082_1086888097 14 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888097 Original CRISPR GGGGCTGAGGGGCGCTGGCG GGG Intergenic