ID: 1086888100

View in Genome Browser
Species Human (GRCh38)
Location 11:92226124-92226146
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888083_1086888100 28 Left 1086888083 11:92226073-92226095 CCTCTACAGGCCAGTGTGTGTGC No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888081_1086888100 30 Left 1086888081 11:92226071-92226093 CCCCTCTACAGGCCAGTGTGTGT No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888082_1086888100 29 Left 1086888082 11:92226072-92226094 CCCTCTACAGGCCAGTGTGTGTG No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data
1086888086_1086888100 18 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888100 11:92226124-92226146 TGGCGGGGAGGCAGTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888100 Original CRISPR TGGCGGGGAGGCAGTAGAGG TGG Intergenic
No off target data available for this crispr