ID: 1086888101

View in Genome Browser
Species Human (GRCh38)
Location 11:92226129-92226151
Sequence GGGAGGCAGTAGAGGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086888086_1086888101 23 Left 1086888086 11:92226083-92226105 CCAGTGTGTGTGCAGGGCAAGTG No data
Right 1086888101 11:92226129-92226151 GGGAGGCAGTAGAGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086888101 Original CRISPR GGGAGGCAGTAGAGGTGGCC TGG Intergenic
No off target data available for this crispr