ID: 1086891690

View in Genome Browser
Species Human (GRCh38)
Location 11:92265847-92265869
Sequence CCCACCTGTTAGTACCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086891684_1086891690 6 Left 1086891684 11:92265818-92265840 CCCTCATGATTTAATCACCTCCT 0: 7
1: 93
2: 758
3: 4012
4: 13035
Right 1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG No data
1086891685_1086891690 5 Left 1086891685 11:92265819-92265841 CCTCATGATTTAATCACCTCCTA 0: 11
1: 203
2: 1958
3: 10123
4: 15728
Right 1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG No data
1086891683_1086891690 23 Left 1086891683 11:92265801-92265823 CCACTCATGAGACTCTACCCTCA No data
Right 1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG No data
1086891682_1086891690 24 Left 1086891682 11:92265800-92265822 CCCACTCATGAGACTCTACCCTC No data
Right 1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG No data
1086891681_1086891690 25 Left 1086891681 11:92265799-92265821 CCCCACTCATGAGACTCTACCCT No data
Right 1086891690 11:92265847-92265869 CCCACCTGTTAGTACCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086891690 Original CRISPR CCCACCTGTTAGTACCACCT TGG Intergenic
No off target data available for this crispr