ID: 1086892772

View in Genome Browser
Species Human (GRCh38)
Location 11:92277629-92277651
Sequence CAATGCTACCACTTACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086892772_1086892779 16 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892779 11:92277668-92277690 AAGATGGCAACAATAGACACTGG 0: 174
1: 669
2: 1378
3: 2470
4: 3170
1086892772_1086892780 17 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892780 11:92277669-92277691 AGATGGCAACAATAGACACTGGG 0: 155
1: 553
2: 1307
3: 2466
4: 4255
1086892772_1086892778 0 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892778 11:92277652-92277674 GGCATACATGGGCGTAAAGATGG No data
1086892772_1086892781 30 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892781 11:92277682-92277704 AGACACTGGGAATACTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086892772 Original CRISPR CAATGCTACCACTTACAAGT GGG (reversed) Intergenic
No off target data available for this crispr