ID: 1086892778

View in Genome Browser
Species Human (GRCh38)
Location 11:92277652-92277674
Sequence GGCATACATGGGCGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086892770_1086892778 16 Left 1086892770 11:92277613-92277635 CCAAATACGGAATGTTCCCACTT No data
Right 1086892778 11:92277652-92277674 GGCATACATGGGCGTAAAGATGG No data
1086892772_1086892778 0 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892778 11:92277652-92277674 GGCATACATGGGCGTAAAGATGG No data
1086892773_1086892778 -1 Left 1086892773 11:92277630-92277652 CCACTTGTAAGTGGTAGCATTGG No data
Right 1086892778 11:92277652-92277674 GGCATACATGGGCGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086892778 Original CRISPR GGCATACATGGGCGTAAAGA TGG Intergenic
No off target data available for this crispr