ID: 1086892779

View in Genome Browser
Species Human (GRCh38)
Location 11:92277668-92277690
Sequence AAGATGGCAACAATAGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7861
Summary {0: 174, 1: 669, 2: 1378, 3: 2470, 4: 3170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086892772_1086892779 16 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892779 11:92277668-92277690 AAGATGGCAACAATAGACACTGG 0: 174
1: 669
2: 1378
3: 2470
4: 3170
1086892773_1086892779 15 Left 1086892773 11:92277630-92277652 CCACTTGTAAGTGGTAGCATTGG No data
Right 1086892779 11:92277668-92277690 AAGATGGCAACAATAGACACTGG 0: 174
1: 669
2: 1378
3: 2470
4: 3170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086892779 Original CRISPR AAGATGGCAACAATAGACAC TGG Intergenic
Too many off-targets to display for this crispr