ID: 1086892780

View in Genome Browser
Species Human (GRCh38)
Location 11:92277669-92277691
Sequence AGATGGCAACAATAGACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8736
Summary {0: 155, 1: 553, 2: 1307, 3: 2466, 4: 4255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086892772_1086892780 17 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892780 11:92277669-92277691 AGATGGCAACAATAGACACTGGG 0: 155
1: 553
2: 1307
3: 2466
4: 4255
1086892773_1086892780 16 Left 1086892773 11:92277630-92277652 CCACTTGTAAGTGGTAGCATTGG No data
Right 1086892780 11:92277669-92277691 AGATGGCAACAATAGACACTGGG 0: 155
1: 553
2: 1307
3: 2466
4: 4255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086892780 Original CRISPR AGATGGCAACAATAGACACT GGG Intergenic
Too many off-targets to display for this crispr