ID: 1086892781

View in Genome Browser
Species Human (GRCh38)
Location 11:92277682-92277704
Sequence AGACACTGGGAATACTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086892773_1086892781 29 Left 1086892773 11:92277630-92277652 CCACTTGTAAGTGGTAGCATTGG No data
Right 1086892781 11:92277682-92277704 AGACACTGGGAATACTAGAGTGG No data
1086892772_1086892781 30 Left 1086892772 11:92277629-92277651 CCCACTTGTAAGTGGTAGCATTG No data
Right 1086892781 11:92277682-92277704 AGACACTGGGAATACTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086892781 Original CRISPR AGACACTGGGAATACTAGAG TGG Intergenic
No off target data available for this crispr