ID: 1086893639

View in Genome Browser
Species Human (GRCh38)
Location 11:92287557-92287579
Sequence CTGTCAAGAAGTAGAGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086893637_1086893639 7 Left 1086893637 11:92287527-92287549 CCCATCTTGCTGTTTGGGTCAGA No data
Right 1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG No data
1086893638_1086893639 6 Left 1086893638 11:92287528-92287550 CCATCTTGCTGTTTGGGTCAGAA No data
Right 1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086893639 Original CRISPR CTGTCAAGAAGTAGAGTTGT AGG Intergenic
No off target data available for this crispr