ID: 1086897727

View in Genome Browser
Species Human (GRCh38)
Location 11:92333086-92333108
Sequence ATACATAAAAATATGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086897727_1086897730 17 Left 1086897727 11:92333086-92333108 CCAAGCACCATATTTTTATGTAT No data
Right 1086897730 11:92333126-92333148 CTGAAAATCAGCAGAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086897727 Original CRISPR ATACATAAAAATATGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr