ID: 1086898161

View in Genome Browser
Species Human (GRCh38)
Location 11:92337097-92337119
Sequence TGTTATCTAAGCTAACTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086898161_1086898162 8 Left 1086898161 11:92337097-92337119 CCTTTAAGTTAGCTTAGATAACA No data
Right 1086898162 11:92337128-92337150 ATGTGTAAGATCTTGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086898161 Original CRISPR TGTTATCTAAGCTAACTTAA AGG (reversed) Intergenic
No off target data available for this crispr