ID: 1086899233

View in Genome Browser
Species Human (GRCh38)
Location 11:92347555-92347577
Sequence GAGCCAAGGCTGTCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086899229_1086899233 2 Left 1086899229 11:92347530-92347552 CCAAAGCAAGCATAGGTACCCTA No data
Right 1086899233 11:92347555-92347577 GAGCCAAGGCTGTCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086899233 Original CRISPR GAGCCAAGGCTGTCCCAGAG AGG Intergenic
No off target data available for this crispr