ID: 1086901112

View in Genome Browser
Species Human (GRCh38)
Location 11:92368688-92368710
Sequence CTCAGGTTATATTCATATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086901103_1086901112 21 Left 1086901103 11:92368644-92368666 CCTAATTTCTCCTCCAAAACTGC 0: 1
1: 0
2: 3
3: 35
4: 539
Right 1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 129
1086901104_1086901112 11 Left 1086901104 11:92368654-92368676 CCTCCAAAACTGCTGTAATTCTA 0: 1
1: 0
2: 4
3: 180
4: 4606
Right 1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 129
1086901105_1086901112 8 Left 1086901105 11:92368657-92368679 CCAAAACTGCTGTAATTCTAGTG 0: 1
1: 0
2: 0
3: 14
4: 457
Right 1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086901112 Original CRISPR CTCAGGTTATATTCATATGG TGG Intronic
904626219 1:31805305-31805327 CTCAGTTTATATTTTTTTGGTGG - Intronic
911056805 1:93715730-93715752 CTCACGTTATAGACAGATGGTGG + Intronic
911279729 1:95909008-95909030 CTTAGGTTATTTTCATATCTTGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
918823716 1:189294500-189294522 CGCAGGTTATATGCCTATAGAGG - Intergenic
919232190 1:194788055-194788077 TTCAGGTTTTATTATTATGGTGG - Intergenic
919354795 1:196507675-196507697 CTCATGTTATATTTATATAAAGG + Intronic
921451075 1:215306353-215306375 GTCTGGGTATGTTCATATGGTGG + Intergenic
923845077 1:237720955-237720977 TTCAGGTCTTATTCATTTGGAGG - Intronic
924388530 1:243524783-243524805 CTGAGGTTACAGTTATATGGAGG - Intronic
1063545903 10:6981375-6981397 TTCATGTTCTATTCATATGTGGG + Intergenic
1064305430 10:14161399-14161421 CTCAGGTTGATTTCATATCGTGG - Intronic
1066052240 10:31646323-31646345 CTTAGGTTTTTTTCAGATGGGGG - Intergenic
1066163339 10:32758467-32758489 CTTAGGTTCTATTTATATGATGG - Intronic
1066990776 10:42511170-42511192 CTCAGCTTACATTTATTTGGGGG + Intergenic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1067941940 10:50664198-50664220 CTCAGGTTACATACACATAGTGG + Intergenic
1068558632 10:58486596-58486618 CTCAGATTTTATTTATAAGGTGG + Intergenic
1070863184 10:79689149-79689171 CTCAGGTTACATACATGTAGTGG + Intergenic
1071151200 10:82636656-82636678 CTCAGGTTATTTCCATATCTTGG + Intronic
1078429686 11:11279542-11279564 CTCACGGTATATTCATATAATGG + Intronic
1079358765 11:19753020-19753042 CTCACTTTATTTTCACATGGTGG - Intronic
1079371637 11:19858475-19858497 CTTAGGTTATTTTCATATCCTGG + Intronic
1081335441 11:41859982-41860004 TTCAGGTGATATTGAAATGGAGG + Intergenic
1083280688 11:61625490-61625512 CTTAGGTTATGTTCATCTGAAGG + Intergenic
1083970694 11:66072386-66072408 TTTAGGTTGTATTCATATGGAGG + Intronic
1086901112 11:92368688-92368710 CTCAGGTTATATTCATATGGTGG + Intronic
1088257543 11:107915539-107915561 CTCAGGTTATAGTGATGTGAGGG - Intronic
1088835885 11:113577733-113577755 CTCAGGCAATGATCATATGGAGG + Intergenic
1089653350 11:119929677-119929699 GTCAGTTCATCTTCATATGGTGG - Intergenic
1090308558 11:125713773-125713795 CTCTGGTTCTGTTCATATGCTGG + Intergenic
1090746798 11:129712126-129712148 ATCAATTTATATTCACATGGTGG - Intergenic
1096350407 12:50894313-50894335 GTGAGGTTATATTCTCATGGTGG - Intergenic
1103395873 12:120606512-120606534 CTTGTGTTATATTGATATGGTGG - Intergenic
1107157110 13:37181220-37181242 CTCTGGGTATATTGATTTGGGGG + Intergenic
1111504620 13:89171490-89171512 TTCAGGTTTTCTTCATATGAAGG + Intergenic
1116956630 14:50930450-50930472 CTCAGCTTTTATTTATTTGGGGG + Intronic
1127593128 15:60447539-60447561 CTCAGGCTCTATGTATATGGTGG - Intronic
1129082786 15:73055038-73055060 CTGAGGTTATAGACATACGGAGG + Intronic
1133635412 16:7660572-7660594 CCTAGGTTATATTCTAATGGAGG - Intronic
1134465478 16:14473163-14473185 CTCCTGTTATATTCTTTTGGTGG - Intronic
1137045385 16:35652985-35653007 CTCAGGTTCTATTCAGTTTGAGG - Intergenic
1139224256 16:65218658-65218680 CTCAGCCTCCATTCATATGGAGG + Intergenic
1148762382 17:50013350-50013372 CTCAGGAAATCTCCATATGGTGG - Intergenic
1153362615 18:4214364-4214386 CTCTGATTTTATTCATAGGGTGG + Intronic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1164878452 19:31710602-31710624 CTAAGGTAATATTTATATGTAGG + Intergenic
929848778 2:45561296-45561318 ATTATGTTATATCCATATGGTGG - Intronic
930900568 2:56502592-56502614 CTTAGGTTATTTCCATATGTTGG + Intergenic
932992919 2:76810353-76810375 ATTAGGTTATATTCTTTTGGTGG - Intronic
933876634 2:86626611-86626633 CTCAGATTCTGTTCATATGTAGG + Intronic
935831246 2:107002826-107002848 CTCAGGTTATAAGCATGGGGTGG + Intergenic
935925316 2:108062144-108062166 CACAGAATATATTCATATGTTGG + Intergenic
938230020 2:129650405-129650427 CTCAGGTTTTATTCATGAGGAGG + Intergenic
938553405 2:132401414-132401436 CTGAGGCTATAATCATATGAAGG + Intergenic
938616162 2:133001057-133001079 CACAGGTTATATGCATTTGTTGG + Intronic
941674136 2:168325758-168325780 TTCAGGTTATCTCCATATGTTGG - Intergenic
942832632 2:180254858-180254880 CACAGCTTATATTCATATTAAGG + Intergenic
944893111 2:204137512-204137534 CTCAGATCATTTTCATATTGTGG + Intergenic
948961221 2:241339581-241339603 GTTAGAGTATATTCATATGGTGG - Intronic
1169531220 20:6487303-6487325 CTCAGGTCATATGAATATAGAGG - Intergenic
1171726926 20:28632143-28632165 CTTAGGTTATTTTCATATTTTGG - Intergenic
1171940416 20:31323588-31323610 CTCTGGATATTTTCATTTGGAGG + Intergenic
1178237534 21:30859722-30859744 CTCACGTTATCCTCACATGGTGG - Intergenic
1180202383 21:46232381-46232403 CTGAGGTTATAGTCATCTGAAGG - Intergenic
1181471373 22:23142249-23142271 CTCAGAGTAAATTCATAAGGTGG + Intronic
1182949136 22:34355144-34355166 CACAGGTTGTATCCATCTGGAGG - Intergenic
955017401 3:55085618-55085640 CTCATGTTATCCTCATATGGTGG + Intergenic
955019992 3:55110590-55110612 CTCAGGATATAGTCAGAAGGGGG - Intergenic
961626336 3:128266445-128266467 CTCAGGTTGCCTTCATTTGGGGG - Intronic
962597648 3:136962980-136963002 CTATGGTTATGTACATATGGAGG + Intronic
966290627 3:178353478-178353500 CATAGCTTCTATTCATATGGAGG + Intergenic
977249466 4:94673917-94673939 CTCAGGTTGAATTTATATGTAGG + Intergenic
977667262 4:99655408-99655430 CTCAGGCTATATTTAATTGGAGG - Intergenic
978946120 4:114499099-114499121 ATCATGTTGTATTCATATGATGG - Intergenic
979912718 4:126389794-126389816 CTCAGTTTATATTCCCATAGTGG + Intergenic
980771768 4:137382537-137382559 CTTAGGTTGTTTTCATATGTTGG + Intergenic
981885755 4:149670749-149670771 CTTAGGTTCTGTTCATATGATGG + Intergenic
986542022 5:8854528-8854550 CTGAGGATATATTCACAAGGCGG - Intergenic
988326500 5:29775474-29775496 GTCATGTTATATTCAAATGGAGG - Intergenic
989745460 5:44824236-44824258 CTCAGGGGATATTGTTATGGTGG - Intergenic
991334115 5:65527912-65527934 CTTATGTTATATCCATATGATGG - Intronic
992885772 5:81158602-81158624 CTCAGGTTATCTTATTATTGAGG - Intronic
995991579 5:118246390-118246412 CTCATGTTATCTTCATCTGAAGG + Intergenic
1000680705 5:164180609-164180631 CTTAGGTTGTTTTCATATGTTGG - Intergenic
1003546714 6:7065462-7065484 CTAGGGTTAATTTCATATGGTGG - Intergenic
1005620340 6:27614307-27614329 ATCTGGTTATATTCATCAGGTGG - Intergenic
1005790835 6:29298626-29298648 CTCAGGTTTTTTTCATTTTGAGG - Intergenic
1006891605 6:37433592-37433614 CTCATGTTATCTTCAAATGAAGG + Intronic
1007298961 6:40851709-40851731 CACAGGTATTATTCATATGCAGG - Intergenic
1008391299 6:50955448-50955470 CTCTGGTTATTTTTAGATGGTGG - Intergenic
1010539991 6:77081344-77081366 CTTAGGTTGTTTTCATATGTTGG - Intergenic
1012507385 6:99963354-99963376 CTCAAGTTTCATTCATATTGTGG - Intronic
1018397355 6:163388494-163388516 CTCAGGTTTTAATCCTTTGGAGG + Intergenic
1020159234 7:5755660-5755682 TTTATGTTATATTCATATAGTGG - Intronic
1021052229 7:16001807-16001829 CTCAGGTGATGTTCATAAGTAGG + Intergenic
1024364308 7:48503702-48503724 CACAGGTTATTTTCATATCTTGG + Intronic
1025109996 7:56206693-56206715 CTCAGGATAAATTCTTATAGTGG - Intergenic
1026538325 7:71258979-71259001 CTCAGGGTATGTGTATATGGGGG + Intronic
1028707940 7:93872706-93872728 CTCAGGTAAATTTTATATGGAGG - Intronic
1029036317 7:97526187-97526209 TTTAGGTTATATTCATAAGAAGG + Intergenic
1033819946 7:145123252-145123274 CTCAGGGTATATACATGGGGTGG + Intergenic
1035047615 7:155979610-155979632 GCCAAGTTATTTTCATATGGGGG + Intergenic
1039865324 8:41496098-41496120 TTCAGGTTATATGTATAAGGTGG - Intronic
1041285706 8:56259328-56259350 TTCAAGTTACATTCATATCGTGG + Intergenic
1041755245 8:61306560-61306582 CTCAGGTTAATTCCATATGCTGG + Intronic
1042080342 8:65044907-65044929 TTCAGGTTATTTTCATAAGGTGG - Intergenic
1043269577 8:78314801-78314823 CTCATATTATATTCTCATGGAGG - Intergenic
1048872788 8:138812809-138812831 CTCAGGCCATATTCTGATGGTGG + Intronic
1050988983 9:12122155-12122177 CTCAGGTTAATTTCATATCTTGG + Intergenic
1051746794 9:20302569-20302591 ATCAGGTTATTTTCATATTTTGG + Intergenic
1051887733 9:21912501-21912523 CTTTGGTTATGTTTATATGGTGG - Intronic
1053722818 9:40964958-40964980 CTTAGGTTATTTTCATATTTTGG + Intergenic
1054343150 9:63887042-63887064 CTTAGGTTATTTTCATATTTTGG - Intergenic
1056235157 9:84586998-84587020 ATCAGGTTTTATTGTTATGGAGG + Intergenic
1058776367 9:108287848-108287870 GCCAGGTGATATACATATGGGGG - Intergenic
1058993495 9:110276950-110276972 CTCCGTTTTTCTTCATATGGTGG + Intergenic
1060099564 9:120827247-120827269 ATCAGGTTATGTGTATATGGGGG - Intronic
1186565015 X:10653016-10653038 TTCAGTTTATATTCTAATGGAGG - Intronic
1188609276 X:32076185-32076207 CTGAGGTTATAATCCTCTGGAGG - Intronic
1188657907 X:32721115-32721137 CTCAGGTTATTTTCATATCTTGG + Intronic
1189136331 X:38554521-38554543 CTCAGGGTAAATCCCTATGGAGG + Intronic
1189606134 X:42680024-42680046 CCTGGGTTATATTTATATGGTGG + Intergenic
1190623917 X:52317522-52317544 TTCAGTTTATATTCTTGTGGGGG + Intergenic
1193442067 X:81554461-81554483 CTTAGGATATTTTCATATTGTGG + Intergenic
1193548104 X:82853677-82853699 CTTAGGTTGTATTCATATCTTGG - Intergenic
1194667873 X:96695476-96695498 CTCAGCTTATATTAAAATGTAGG - Intronic
1195027310 X:100890088-100890110 CTCTGGTTGTATTCATTTGCTGG - Intergenic
1197563314 X:128050810-128050832 TTGAGGTTATGTTCATATAGAGG - Intergenic
1197627282 X:128816235-128816257 CTCAGCTTTTGTTCACATGGAGG - Intergenic
1198300496 X:135329962-135329984 TTCATGTCAAATTCATATGGAGG - Intronic
1199558363 X:149134482-149134504 CTTAGGTTATTTTCATATCTTGG + Intergenic