ID: 1086905647

View in Genome Browser
Species Human (GRCh38)
Location 11:92415168-92415190
Sequence ATGGCTATCCACACTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086905647 Original CRISPR ATGGCTATCCACACTGAAAT TGG (reversed) Intronic
900872221 1:5312223-5312245 ATGGCCACCCACACTGAATGGGG - Intergenic
909352999 1:74675553-74675575 ATGTCTATCCCCACTAACATTGG + Intergenic
910277898 1:85467413-85467435 ATGTCTTTCCATACTGAAATTGG + Intronic
914912861 1:151801241-151801263 ATTGCTAACCACACAGACATAGG + Exonic
918235607 1:182577430-182577452 AGGGCTATTCAGACTGAAACTGG + Intronic
1063284244 10:4665695-4665717 ATGGCTATCAAACATGAAATAGG - Intergenic
1063765397 10:9134370-9134392 ATGGCTATCAACATTGCAAAAGG - Intergenic
1067462635 10:46468963-46468985 ATGGCTCTCCACACAGTTATGGG + Intergenic
1067624560 10:47915674-47915696 ATGGCTCTCCACACAGTTATGGG - Intergenic
1067921137 10:50458942-50458964 CTGGCTATACACATTGAAAGTGG + Intronic
1072654998 10:97323681-97323703 AGGGCTTTCCATCCTGAAATAGG + Intergenic
1074585650 10:114765778-114765800 CTGGTTCTCAACACTGAAATAGG + Intergenic
1075594297 10:123716845-123716867 ATGGCTATCAACACTGACCAGGG + Intronic
1080564598 11:33496519-33496541 GAAGCCATCCACACTGAAATGGG - Intergenic
1081718076 11:45265446-45265468 ATAGCTATCCAAACTGAGATAGG - Intronic
1081740405 11:45435565-45435587 GTGGCAATCCACACTGCAAAGGG - Intergenic
1086905647 11:92415168-92415190 ATGGCTATCCACACTGAAATTGG - Intronic
1089102978 11:115979822-115979844 ATGTCTATCAACAGTAAAATAGG - Intergenic
1090580846 11:128157028-128157050 ATGTCTCTCGACCCTGAAATGGG + Intergenic
1090592978 11:128291953-128291975 ATGGCTATGCACTCTGAGGTTGG - Intergenic
1090970780 11:131641092-131641114 ATGGCTGTCGACACTGACACTGG + Intronic
1092572661 12:9741994-9742016 TGGTCTAACCACACTGAAATGGG + Intergenic
1095319665 12:40811179-40811201 TTGGATATACACCCTGAAATCGG + Intronic
1102752590 12:115308701-115308723 ATGGGCATCCACAATGATATGGG - Intergenic
1113186858 13:107697159-107697181 AAGGCTATGGAAACTGAAATAGG + Intronic
1119795531 14:77393037-77393059 ATGGCTTACCACTATGAAATAGG + Intergenic
1120235961 14:81891233-81891255 ATCTCTATCCTAACTGAAATGGG - Intergenic
1121530131 14:94646655-94646677 ATGACTTTCCACACGGAAACAGG + Intergenic
1129641505 15:77383352-77383374 AAGAATATCCACACTGCAATAGG + Intronic
1130712791 15:86300298-86300320 ATAGCTCTCCAAACTAAAATGGG - Intronic
1132069253 15:98761348-98761370 ATGCCTAGCCACACTGAGAAAGG + Intronic
1133213480 16:4276016-4276038 CTGGCTGCCCACACTGAACTGGG + Intergenic
1134881885 16:17752000-17752022 ATGGCAAGTCACACTGACATGGG + Intergenic
1135421072 16:22305932-22305954 ATTGCATTACACACTGAAATGGG - Intronic
1138049538 16:53761616-53761638 TTGACTATCCTCACGGAAATTGG + Intronic
1141292395 16:82731618-82731640 ATGGCAATCAACATTGATATGGG + Intronic
1143228842 17:5333574-5333596 ATAGCTATACACTCAGAAATAGG - Intronic
1150703348 17:67466626-67466648 AGGGCTAACAACACTGAATTCGG - Intronic
1155012799 18:21797944-21797966 AAGGATAACCATACTGAAATGGG - Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1158578691 18:58662456-58662478 ATGGCTGTACACACTGCAAACGG - Intergenic
1167290487 19:48622377-48622399 AAAGCTATTCACACTGAAACAGG - Intronic
1168613374 19:57818671-57818693 ATTGCTCTCCTCACTGAGATAGG - Intronic
928154506 2:28864360-28864382 ATGTCTATCAACAGTAAAATAGG + Intronic
932827210 2:74952632-74952654 ATGGCTGTTCACACTGAGTTAGG - Intergenic
937825057 2:126359825-126359847 ATAGGTTTCCACACTGAAAATGG - Intergenic
938871206 2:135478720-135478742 CTGTCTATCCACTCTGTAATGGG - Intronic
941279258 2:163530202-163530224 ATGGGCATCCAAAATGAAATTGG - Intergenic
941782211 2:169457381-169457403 ATGACTATCCTCACGGAATTGGG + Intergenic
943906266 2:193503463-193503485 ATGGCTATCCACCTAGAAAGAGG + Intergenic
945501850 2:210585559-210585581 ATGGCCATTCACACTGAAGAAGG - Intronic
948978500 2:241479630-241479652 GAGTCTATCCACACTGAAAAGGG - Intronic
1171054676 20:21895030-21895052 CTGATTTTCCACACTGAAATGGG - Intergenic
950306196 3:11916855-11916877 CTGGCTTTCCTCACTGAAATCGG - Intergenic
955944970 3:64184827-64184849 TTGACTATCCACACAGCAATGGG + Intronic
959599733 3:108167965-108167987 AGGGCTATCCCACCTGAAATAGG - Intronic
963373123 3:144427496-144427518 ATGGCAGTCCACAGTAAAATAGG + Intergenic
970943383 4:21661556-21661578 ATTGCTATTCAAATTGAAATGGG - Intronic
980604289 4:135069129-135069151 ATGGATGTCCTCACTGAAAAGGG + Intergenic
981439505 4:144767439-144767461 TTGGGTATACACACCGAAATGGG - Intergenic
983292751 4:165826692-165826714 GTAGTTATCTACACTGAAATTGG + Intergenic
985203851 4:187511618-187511640 ATTGAGATCCAGACTGAAATGGG + Intergenic
987520231 5:18972857-18972879 AATCCTATTCACACTGAAATGGG + Intergenic
988212971 5:28230181-28230203 ATGAATATCAAAACTGAAATGGG - Intergenic
998947698 5:147358531-147358553 ATGGCTATCAACAATGGGATAGG + Intronic
1002865162 6:1115352-1115374 AGGGCCAACCACACTGAAAGAGG - Intergenic
1005075024 6:21898499-21898521 ACGGCTATCCACACAGCATTAGG - Intergenic
1005215249 6:23519481-23519503 ATGTCTGTACATACTGAAATAGG + Intergenic
1006550279 6:34817198-34817220 ATGGCTATCTACAAGGAAATAGG - Intronic
1010529316 6:76947518-76947540 ATGGCAATCTTCACAGAAATAGG + Intergenic
1010529691 6:76952501-76952523 ATGGCTATTCACTGTGAAAGTGG - Intergenic
1011740498 6:90354870-90354892 ATGGACATCCACACACAAATTGG + Intergenic
1014662975 6:124196525-124196547 ATGCCTATTAACACTGAAACAGG + Intronic
1018349520 6:162942475-162942497 CTGGTTATCCACACTGAATAGGG - Intronic
1023470916 7:40518196-40518218 ATGAATGACCACACTGAAATGGG + Intronic
1031335338 7:120523135-120523157 ATGGTTTACCACTCTGAAATGGG - Intronic
1032906587 7:136374587-136374609 CTGGCTCTGCACACTGAAACTGG - Intergenic
1037076223 8:14722556-14722578 ATTACTTTCCTCACTGAAATGGG + Intronic
1040064950 8:43138199-43138221 ATGGCTACCCACATAGAAAGAGG - Intergenic
1040761586 8:50851978-50852000 ACTGCTAACCACACTGATATTGG + Intergenic
1041606478 8:59787885-59787907 ATGGCTATGAAGACAGAAATTGG - Intergenic
1044051348 8:87509662-87509684 ATGCCTACCCACACTGAGAAGGG - Intronic
1044516385 8:93143551-93143573 ACTGCTGTCCACACTGACATGGG + Intronic
1046165883 8:110434800-110434822 ATTGCTATGCACACTTATATGGG - Intergenic
1048538316 8:135318271-135318293 AAGTCTATCCACACAGAAACTGG + Intergenic
1049535162 8:143176657-143176679 ATGGCTAACACCACTGAAAACGG + Intergenic
1050113962 9:2243778-2243800 ATGAATAACCACACTGAAAGGGG + Intergenic
1057020271 9:91691910-91691932 ACCCCTATCCCCACTGAAATGGG - Intronic
1059177978 9:112184935-112184957 ATGTCCATCCACAATGGAATGGG - Intergenic
1186636641 X:11412905-11412927 ATGGCAATCCAAATTGAAACAGG - Intronic
1188399115 X:29723121-29723143 ATTTATACCCACACTGAAATTGG - Intronic
1188683045 X:33035274-33035296 ATGGATATACACACAGTAATTGG + Intronic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1189607515 X:42695565-42695587 ATTTCTGTCCACACTGAAGTGGG + Intergenic
1193045802 X:77052408-77052430 ATGGCATTCCTCACAGAAATAGG + Intergenic
1193955127 X:87850642-87850664 ATGGATATCATCACTGAACTTGG + Intergenic
1197984334 X:132251580-132251602 TTGGCTATACACACAGTAATGGG - Intergenic