ID: 1086907753

View in Genome Browser
Species Human (GRCh38)
Location 11:92436485-92436507
Sequence AGATCCCTTTGTTAAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086907745_1086907753 17 Left 1086907745 11:92436445-92436467 CCCTTTAGTTTGATACCCAAAGT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1086907744_1086907753 22 Left 1086907744 11:92436440-92436462 CCTCTCCCTTTAGTTTGATACCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1086907747_1086907753 2 Left 1086907747 11:92436460-92436482 CCCAAAGTCCTGTTTGCCTTGCT 0: 1
1: 0
2: 0
3: 30
4: 194
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1086907746_1086907753 16 Left 1086907746 11:92436446-92436468 CCTTTAGTTTGATACCCAAAGTC 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1086907748_1086907753 1 Left 1086907748 11:92436461-92436483 CCAAAGTCCTGTTTGCCTTGCTA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1086907749_1086907753 -6 Left 1086907749 11:92436468-92436490 CCTGTTTGCCTTGCTACAGATCC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086907753 Original CRISPR AGATCCCTTTGTTAAGGGAC AGG Intronic