ID: 1086908968

View in Genome Browser
Species Human (GRCh38)
Location 11:92450161-92450183
Sequence CAATGAATGAAACCTCAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086908968_1086908973 22 Left 1086908968 11:92450161-92450183 CCTCGTTGAGGTTTCATTCATTG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1086908973 11:92450206-92450228 ATTTCTCCTTCTTTTAAATGTGG 0: 1
1: 1
2: 10
3: 169
4: 1508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086908968 Original CRISPR CAATGAATGAAACCTCAACG AGG (reversed) Intronic
908599905 1:65727469-65727491 CAAATAATGCAACCTCAACCAGG - Intergenic
908635080 1:66154527-66154549 CCATGAATGAAACCAAAAAGTGG - Intronic
916077952 1:161213762-161213784 CAATGAATTAAACCTGACCTTGG + Intronic
919776302 1:201196082-201196104 GAATGGATTCAACCTCAACGAGG - Intronic
922061075 1:222092251-222092273 CAATGAATGCAAATTCAAAGAGG + Intergenic
922924005 1:229332210-229332232 AAATTAATCAAACCTAAACGGGG + Intronic
923967194 1:239155222-239155244 GAATGAATGAGACCTTAATGTGG + Intergenic
924327008 1:242905375-242905397 TAATCAATGAAACCACAAGGTGG + Intergenic
1063447633 10:6129472-6129494 CAATGCATGAAACCACAGCCTGG - Intergenic
1075465892 10:122649925-122649947 CAATGAAGGAAACTTGAACATGG - Intergenic
1075622065 10:123935286-123935308 CAATGAATAAAACCTTAAGCTGG + Intronic
1077457225 11:2688366-2688388 CAGTTATTGAAACCTCTACGGGG - Intronic
1079234620 11:18679320-18679342 CAATGTATAAAACCCCAAGGTGG + Intergenic
1083513150 11:63230596-63230618 AAATGAATTATACCTCAATGAGG - Intronic
1084527663 11:69706697-69706719 CAATGAATGAAACCCCACCTGGG - Intergenic
1086908968 11:92450161-92450183 CAATGAATGAAACCTCAACGAGG - Intronic
1089049215 11:115531478-115531500 AAATGAATGAAAACCCAACGAGG - Intergenic
1097903382 12:64895776-64895798 CAATGAATGATTCGTCAACCAGG - Intergenic
1099606476 12:84808467-84808489 AGATGAATGAAACCTCATGGTGG - Intergenic
1100348532 12:93755618-93755640 CAATGAATTACACCTAAAGGAGG - Intronic
1100869951 12:98899931-98899953 CAATGATAGTAACCTCAACCAGG + Intronic
1101961101 12:109250895-109250917 CAATGCATAAAACCTCAAAAGGG - Intronic
1107422025 13:40256097-40256119 CAATGAATTAAAACTAAACCTGG - Intergenic
1109444261 13:62412700-62412722 CACTGTATGAAACTTCAATGAGG + Intergenic
1114988921 14:28263525-28263547 CAATGAGAGAAACCTCATCATGG + Intergenic
1119443938 14:74648141-74648163 CACTGAATGAAACCTAAAGCTGG - Intergenic
1120122949 14:80704408-80704430 AAATGAATGAAATGTCAAAGAGG + Intronic
1124558243 15:30747391-30747413 CAGTGAATGAACTCTCAACAGGG - Intronic
1124673011 15:31658259-31658281 CAATGAATGAACTCTCAACAGGG + Intronic
1127554681 15:60076206-60076228 GAATGAATGAAATTTCAAAGTGG - Intergenic
1127653300 15:61030244-61030266 CAATGGGTGAAACTTGAACGGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1130624523 15:85500125-85500147 CAATAAATGAAACCACACAGGGG + Intronic
1135138114 16:19899454-19899476 CACTGAATGAGACCTGAAAGCGG - Intergenic
1135684830 16:24490457-24490479 CAAGGAATGAAAGCTCCACAAGG + Intergenic
1140276910 16:73517580-73517602 CAAAGAGTGAAACCACAATGAGG + Intergenic
1148222406 17:45872316-45872338 GAATGAATGAAAGCTGAACCGGG + Intergenic
1151448056 17:74180297-74180319 CAAGGAATGAAATCTCAGCCTGG - Intergenic
1156109915 18:33713549-33713571 CAATGAATGAAAGCTCAGGCCGG - Intronic
1156667613 18:39426706-39426728 CAATGAACAAAACCTCCAAGAGG + Intergenic
1159009360 18:63043550-63043572 GAATGAATGAAACCACAAGTGGG - Intergenic
1165380967 19:35480048-35480070 CAACGAAGGAAACCTGAACACGG - Intergenic
1167135721 19:47614085-47614107 GAATGAATGAAACCCCACAGCGG - Intronic
925953046 2:8933905-8933927 GAATGACTGAAACCTCAACAGGG + Intronic
931710419 2:64985316-64985338 CAATGACTGAAACCCCAAGCTGG - Intergenic
943530192 2:189070082-189070104 ATATGAATGAAAACTCAACTAGG - Intronic
944132493 2:196361915-196361937 CTATGAATGAAACTGCCACGTGG - Intronic
945903609 2:215566356-215566378 CATTGAATGCACCATCAACGTGG + Intergenic
946452005 2:219788188-219788210 GAATGAATGAAAAGTAAACGAGG - Intergenic
948466631 2:238155274-238155296 CAATAAATGAAACCACATCCAGG - Intergenic
1169156365 20:3333586-3333608 CAATGAATGAAAACTCATGGAGG + Intronic
1169319268 20:4617886-4617908 CTATGAATCAAACCTAAACAAGG + Intergenic
1169896792 20:10513089-10513111 CAGTGAAGGAAAACTCAAGGAGG + Intronic
1170232033 20:14059645-14059667 CAAAAAATGAAACCTCATCAGGG - Intronic
1172504258 20:35449691-35449713 GAATGAATGGAACTTCAGCGCGG + Intronic
1181152206 22:20892711-20892733 AAATGCATGAAGACTCAACGAGG - Intergenic
1181575080 22:23788765-23788787 GAATGAATGAAGCCTCAAGATGG + Intronic
949121940 3:395838-395860 CAATGAAAGAAACATCACAGAGG + Intronic
949796173 3:7853788-7853810 TAATGACTGAGATCTCAACGTGG + Intergenic
951845827 3:27083269-27083291 TAAAGAATGAAAGCTCTACGGGG - Intergenic
959264702 3:104122262-104122284 CAATTGATGTAACCTCAACATGG - Intergenic
961587765 3:127948106-127948128 AAAAGAATGGAACCTCAAAGAGG + Intronic
961955239 3:130794539-130794561 AAATGAATTAAATCTCAATGAGG - Intergenic
963624754 3:147657358-147657380 CAATGAATGAAAGCTAAGTGGGG - Intergenic
963944388 3:151129645-151129667 GAATGAATGAAACTTCAAAAAGG - Intronic
964911507 3:161788089-161788111 CAATGAGTGAAACTTGAACAGGG - Intergenic
966659302 3:182396639-182396661 GAATGAATGAACCCTCAATCTGG - Intergenic
969075022 4:4571109-4571131 CAAAGGATGAAACCTGAATGTGG - Intergenic
972183466 4:36498521-36498543 GAATGGATGAAACCTTAATGAGG + Intergenic
973550388 4:52029210-52029232 AACTGAATAAAACCTCAAGGAGG - Intronic
979170275 4:117593420-117593442 CATTGAAAGAAAGCTCAACAGGG - Intergenic
980195390 4:129581908-129581930 CAATGAGTGAAACTTAAATGGGG - Intergenic
984937696 4:184903776-184903798 AAATGAATAAAACGTCAAGGAGG + Intergenic
985974862 5:3409368-3409390 CAATGCAAAAATCCTCAACGAGG - Intergenic
986778968 5:11046680-11046702 CATTGAATGATATCTCAACTTGG + Intronic
987035802 5:14017237-14017259 CAGTGAATGAAATCTCAAATTGG + Intergenic
987631299 5:20476661-20476683 TAATGCATGAAACTTCAAAGAGG - Intronic
989588997 5:43096101-43096123 CAGTGAAAGAAATCTCAAGGAGG + Intronic
993169986 5:84406836-84406858 CAATGAAGGAAAGCTCTATGAGG - Intergenic
993233518 5:85270794-85270816 CACTGAATGAAACCTCTTCCAGG - Intergenic
996259866 5:121453745-121453767 CAATGCATAAAACGTCAATGTGG + Intergenic
996883563 5:128328629-128328651 CAGTAAATGAAACCACAACAAGG - Intronic
1000514168 5:162219650-162219672 CAAGGAATGAAAGCTCCAAGAGG - Intergenic
1001590833 5:172863893-172863915 CAATACATGAAAACTCAACATGG + Intronic
1002337278 5:178488748-178488770 CAATGAATGTAAATTCAAGGAGG + Intronic
1002667749 5:180838479-180838501 CAATGAAAGAAACTTGCACGGGG + Intergenic
1006828895 6:36956989-36957011 GAATGAAAGAAACCTGAACCAGG - Intronic
1007264081 6:40584395-40584417 AATGGAATGAAACCTCAACTTGG - Intronic
1009637721 6:66286489-66286511 AAATGAATAAAACCTCTACATGG - Intergenic
1010392737 6:75355868-75355890 CAATGAATTAGAACTCAAAGGGG - Intronic
1010455260 6:76047341-76047363 CAATGAATGAATTCTGAATGTGG - Intronic
1012201413 6:96411073-96411095 CAATGAATGAAAGCTCCTTGAGG - Intergenic
1014813933 6:125915011-125915033 CAATAAATGAAGACTCAATGAGG + Intronic
1015071795 6:129103462-129103484 AAATGAATGAAACCTGAATAAGG - Intronic
1017630295 6:156390610-156390632 CAAAGAATGCAACCTCAAGCCGG + Intergenic
1018497492 6:164364679-164364701 AAATCAATGAAACCTAAAGGTGG + Intergenic
1019585091 7:1796496-1796518 AAATGAATGAAACCAAAACATGG + Intergenic
1021003018 7:15357417-15357439 TAATAAATAAAACCTCAGCGTGG + Intronic
1021549439 7:21854332-21854354 AAATGAAAGAAAAATCAACGAGG + Exonic
1036062442 8:5339065-5339087 CAATGTAAGAAACATAAACGCGG + Intergenic
1037313521 8:17579899-17579921 CTATGATTGACATCTCAACGTGG - Intronic
1039273545 8:35909378-35909400 AAATGAATGTCACCTCTACGGGG + Intergenic
1042632975 8:70841497-70841519 CAATGAGTGAAACTTGAATGGGG - Intergenic
1042676452 8:71327148-71327170 CAAAGAATGAAAGCTCCATGAGG + Intronic
1055303659 9:74906579-74906601 CAATGAATGAATTCACACCGTGG + Intergenic
1055931388 9:81563109-81563131 AAATCAATGAAACCCAAACGGGG + Intergenic
1055992045 9:82116943-82116965 CAATGAATTACACCTCAGTGGGG - Intergenic
1056127740 9:83553536-83553558 GAATGAACAAAACCTCAAAGAGG - Intergenic
1056280410 9:85036310-85036332 CAATCAATCAATCCTCATCGTGG + Intergenic
1057929384 9:99180387-99180409 CAACATATGAAACCTCAACTTGG - Intergenic
1058875984 9:109245228-109245250 CAATGAATGGAACCTCATTCTGG - Intronic
1061671135 9:132188793-132188815 GAATGAATGAACGCTCAATGAGG - Intronic
1196675617 X:118417854-118417876 ATATGAATGAAGCCTCTACGAGG - Intronic
1198371782 X:135996706-135996728 GAATGAATGAAACCCCAAACTGG - Intronic
1199858608 X:151780030-151780052 CAATGAATGAGTGGTCAACGTGG - Intergenic
1201224448 Y:11804291-11804313 TAATCAATGAAACCACAAGGTGG + Intergenic
1201460968 Y:14224035-14224057 AAATAAATTAAACATCAACGTGG - Intergenic