ID: 1086909902

View in Genome Browser
Species Human (GRCh38)
Location 11:92460010-92460032
Sequence CCCTGGCAGCAATAAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086909902 Original CRISPR CCCTGGCAGCAATAAACCCT GGG (reversed) Intronic
901888350 1:12240231-12240253 CCCTGGCAGCTGTACAACCTTGG - Intronic
902970221 1:20043048-20043070 GCCTTGCAGCAATACAGCCTAGG + Intronic
906789010 1:48642439-48642461 GCTTGGCAGCAACAAACACTGGG + Intronic
912196310 1:107401221-107401243 CCCAGGCAGTAAATAACCCTCGG - Intronic
920214218 1:204350744-204350766 CCCTGGCAGTGATAAAACCAGGG - Intronic
924286274 1:242490815-242490837 CCTTGGCAACAGTAGACCCTGGG + Intronic
1063010388 10:2016034-2016056 GCATGGCAGCAATAACACCTGGG + Intergenic
1063066286 10:2612513-2612535 ACCTGGCTGCTCTAAACCCTAGG - Intergenic
1063095893 10:2908670-2908692 CCCTGGCAGCAAATAACACATGG - Intergenic
1063711926 10:8487572-8487594 GACAGGCAGCAATAAACCGTAGG - Intergenic
1064579355 10:16778412-16778434 TCCTGGGAGCAATGAACACTCGG + Intronic
1069909255 10:71749760-71749782 GCCTGGCAGCAGTGAGCCCTGGG - Exonic
1073455227 10:103632673-103632695 CCCTGGCATCAACAGAGCCTGGG + Intronic
1075225841 10:120628336-120628358 CCCTGGCAGTAAGATATCCTGGG - Intergenic
1077077616 11:708582-708604 CCCTGGCAGCAGCCAAGCCTAGG - Intronic
1077529645 11:3089205-3089227 CCCTGGCTGCATTTCACCCTGGG + Intronic
1079240994 11:18721893-18721915 CACAGGCAGCAACACACCCTCGG + Exonic
1084708995 11:70832430-70832452 CCGTGGCAGCAGTCAGCCCTTGG + Intronic
1085154209 11:74278589-74278611 CCCTGGAAGCAATTAACCCAAGG + Intronic
1085482211 11:76832041-76832063 TCCTGGCAGCTTTAAACCTTTGG - Intergenic
1086909902 11:92460010-92460032 CCCTGGCAGCAATAAACCCTGGG - Intronic
1088105740 11:106204690-106204712 CCCTAACAGCAAGAAACACTGGG - Intergenic
1089595430 11:119576118-119576140 CCTAGGCAACAAGAAACCCTAGG - Intergenic
1094058333 12:26288153-26288175 CCTTGGCAGCAACACACCCTGGG - Intronic
1094303724 12:28994780-28994802 CCCTTGCAGCCATAAACCCCAGG - Intergenic
1101521644 12:105488050-105488072 CCCTGACAGCAATTAACCTTTGG + Intergenic
1103735465 12:123058175-123058197 CCCTGGCAGCCCTACAACCTTGG - Intronic
1103842330 12:123875338-123875360 CCATTGCAGCAATAAAGCCAAGG - Exonic
1106132437 13:26951529-26951551 GCCTGGCAGCAGGAAACCCCAGG - Intergenic
1106189889 13:27442426-27442448 CCCTAGCAGTAATAAACTCCAGG - Intronic
1107367393 13:39697515-39697537 CCCTGGAATTAATAAACACTTGG + Intronic
1108015054 13:46065768-46065790 CCGTGGCAACAATAGGCCCTGGG + Intronic
1114557115 14:23568367-23568389 CCCTGGGAGCAGGAAGCCCTAGG - Exonic
1114996327 14:28356906-28356928 TGATGGCAGCAATAAACACTGGG + Intergenic
1117218747 14:53579882-53579904 CCCTTGCAGATATAAACACTTGG + Intergenic
1118471964 14:66082438-66082460 CCCTGGCTGCAAGGGACCCTGGG + Intergenic
1118894933 14:69937979-69938001 CCCTTACAGCACTAAGCCCTGGG - Intronic
1119384662 14:74250289-74250311 CCCTGCCAGCTATCAGCCCTGGG + Intronic
1120085889 14:80272338-80272360 ACATGGCAGCAATAAACCAGAGG - Intronic
1120155386 14:81087805-81087827 CCCTGGCAGCTACAGCCCCTGGG + Intronic
1120628928 14:86865017-86865039 AGCTGGCAGCAATAGACCCCGGG - Intergenic
1125141201 15:36409804-36409826 CGATGGCAGCAATAGACTCTGGG - Intergenic
1126986189 15:54312541-54312563 CCCTGGGAACAATATACCCTGGG - Intronic
1127101164 15:55566244-55566266 AGATGGCAGCAATAGACCCTGGG - Intronic
1129930744 15:79408641-79408663 CCCTGGAAGCCAGAAACCCAGGG + Intronic
1130117805 15:81020606-81020628 CCATGGCAGAAATGGACCCTGGG - Intronic
1133738401 16:8632961-8632983 CCCTGGCAGCAGGAACCCTTAGG + Intronic
1143108014 17:4539049-4539071 CCCTCACAGCAAAAAAGCCTGGG + Intronic
1144794580 17:17882462-17882484 CCCAGGCACCACTCAACCCTGGG + Intronic
1145019190 17:19416447-19416469 CACTTGCAGCCAGAAACCCTGGG - Exonic
1147847176 17:43412767-43412789 CCCTGGCAGCCCAAAACCTTTGG + Intergenic
1147904394 17:43813494-43813516 CCCTGGCAGCAGTAAGCCCCAGG + Intronic
1148961451 17:51396730-51396752 AGCTGGCAGCATTAGACCCTGGG + Intergenic
1153653399 18:7261340-7261362 CTTTGGGAGCAATAAATCCTAGG - Intergenic
1155375507 18:25152572-25152594 CTCTGGCAGTAAAAATCCCTTGG - Intronic
1155791866 18:29982263-29982285 TCCTGGAAGCAATAATCCCCAGG - Intergenic
1160089793 18:75816141-75816163 ACCTGGCAGCCAAAAATCCTAGG + Intergenic
1163390740 19:17028306-17028328 CCCAGGCAGCACCAAGCCCTGGG + Intergenic
1163655170 19:18541730-18541752 CCATGGCAGCAAGGAACTCTCGG + Exonic
1167813379 19:51855196-51855218 CAATCGCAACAATAAACCCTGGG - Intergenic
1168453244 19:56482811-56482833 CACTGGCAGCCATAAGCCTTGGG - Intergenic
925488761 2:4368781-4368803 CTCTAGCAGCAATCCACCCTTGG - Intergenic
926695693 2:15768954-15768976 CCCAGGCAGCAAGAAACGTTCGG + Intergenic
927062871 2:19440803-19440825 CCCTGGCATGGAGAAACCCTTGG + Intergenic
927724275 2:25409109-25409131 GGCTGGCATGAATAAACCCTGGG + Intronic
927728471 2:25447835-25447857 CCCTTGAAGCATTATACCCTTGG - Intronic
929840280 2:45453127-45453149 GCTTGGCAGCAACAAACTCTAGG + Intronic
940437132 2:153668741-153668763 TCCTGGCAGCAGTGCACCCTAGG + Intergenic
941115970 2:161472648-161472670 CCCTGGTACCAAAAAAGCCTGGG - Intronic
942567577 2:177281879-177281901 CCCTTGCAGTAAGAACCCCTAGG - Intronic
944311204 2:198235757-198235779 CACTTTCAGAAATAAACCCTTGG + Intronic
947156530 2:227167405-227167427 CCCTGACAGCTATAAAACCTGGG - Intronic
1169781770 20:9317753-9317775 AGCTGGCAGCAAGAACCCCTAGG - Intronic
1169860981 20:10151978-10152000 CCTTGGAAGCACTAAACCATGGG - Intergenic
1170579061 20:17684270-17684292 GCCTTGCAGCAAGAAGCCCTTGG + Intergenic
1172919411 20:38468643-38468665 CCCTGGCTGCAATAAGCCAGAGG + Intergenic
1173136187 20:40441284-40441306 TCCTGGGATCAATAAACCCTGGG - Intergenic
1174168108 20:48599151-48599173 CCCTGGCAGGACTGATCCCTGGG + Intergenic
1175719828 20:61279358-61279380 CCCAGGCAGCAAGGAAACCTCGG + Intronic
1177081751 21:16648206-16648228 CTCTGGCTGGAATAAACCCAAGG + Intergenic
1178159710 21:29897713-29897735 CACAGGCAGCCATAAACCATGGG + Intronic
1178343732 21:31807597-31807619 GCCTGGCACCACTAAACACTAGG + Intergenic
1181625618 22:24120324-24120346 CCCTGGAAGCACTTAAGCCTGGG - Intronic
1181658692 22:24323412-24323434 CCCTGCCAGCAATAAATCACAGG - Intronic
1181998118 22:26899006-26899028 CCCTGGAAGCAATACCTCCTAGG - Intergenic
949806948 3:7965969-7965991 CTCTGGGAGCAATACACACTTGG + Intergenic
951671159 3:25183587-25183609 CACTGCCACCAATAATCCCTCGG - Intronic
953151062 3:40325279-40325301 CGATGGCAGCAATAGACACTGGG + Intergenic
955351822 3:58199256-58199278 ACCTGGCAGCAATAAACAATAGG + Intronic
961433441 3:126899632-126899654 ACCTGGGAGAAATAATCCCTTGG + Intronic
964175842 3:153825631-153825653 GCCTGGCAGCAGTACAGCCTAGG + Intergenic
964254752 3:154763555-154763577 ACATGGGAGCAATAAACACTGGG - Intergenic
966067015 3:175831041-175831063 GCCTTGCAGCAGTAAAGCCTAGG - Intergenic
967621368 3:191638727-191638749 CCCTGGCAGGAATAGCCACTAGG + Intergenic
971994086 4:33941655-33941677 CCCTGGCAGAAATATAAACTAGG + Intergenic
973555028 4:52074104-52074126 CTCTGGCCACAATAAATCCTAGG + Intronic
974997125 4:69175256-69175278 CCATGGCACCTATAAAACCTGGG - Intronic
975996571 4:80322124-80322146 CCCTGGCCCCAGTAAGCCCTCGG + Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
981008960 4:139904793-139904815 GCCTAGCAGCAATAGACCCCAGG - Intronic
981283217 4:142984975-142984997 GCCAGGCAGAAATAAACCTTGGG - Intergenic
981431531 4:144667026-144667048 CACTGCTAGCAATACACCCTGGG + Intronic
983513747 4:168635670-168635692 CCTTGGCAGCCATCAACCCAGGG + Intronic
983857846 4:172667561-172667583 CCCTGCCAGCAATCAGCCCAGGG + Intronic
985573430 5:662715-662737 CCCTGGCACCCTTACACCCTCGG - Exonic
986830194 5:11568398-11568420 CCCTGTAAGCCATAGACCCTTGG - Intronic
989304259 5:39933631-39933653 CCCTGTCCCCAAGAAACCCTTGG + Intergenic
991022673 5:61996669-61996691 CCCAGGCAGCAAGAAAACTTAGG - Intergenic
993605682 5:89988283-89988305 CCCTAACAGCAAGAATCCCTGGG + Intergenic
996666236 5:126063541-126063563 CCCAGGCAGAAAGAAACTCTCGG + Intergenic
996853562 5:127979460-127979482 ACCAGGCAGAAATAAACCCGAGG - Intergenic
997655205 5:135549255-135549277 CCTTGGCACCAAGAGACCCTAGG + Intergenic
998929408 5:147163988-147164010 CCCTAGCTGCAATAAAAGCTAGG - Intergenic
999335240 5:150710355-150710377 CTGTGGCAGCATTAATCCCTGGG + Intronic
1000407736 5:160906659-160906681 TCCTGGCAGCAAGAGATCCTGGG - Intergenic
1001342767 5:170862363-170862385 CCCTGGCAACACTAAAGCCGCGG - Intronic
1002436611 5:179235546-179235568 TCCTGGCAGCACCAACCCCTAGG - Intronic
1005175596 6:23040971-23040993 CCCTGGAAGCAATGAAAGCTGGG - Intergenic
1013879889 6:114884484-114884506 CGATGGCAACAATAAACACTAGG + Intergenic
1013929473 6:115513968-115513990 CCCTGGCAGAAATGGATCCTAGG - Intergenic
1015027338 6:128551520-128551542 CCATGGCAGCAGAAAACCTTAGG - Intergenic
1022659654 7:32355039-32355061 CCCTGGCAGGAACCAACCCCTGG + Intergenic
1023506552 7:40905226-40905248 TCCAAGCAGCAAGAAACCCTTGG + Intergenic
1023656168 7:42423074-42423096 CTATGACAGCAATACACCCTGGG - Intergenic
1029272722 7:99386467-99386489 TACTCGCAGCAATGAACCCTGGG - Intronic
1030170971 7:106602490-106602512 CCATGGCTGCACTAAAACCTAGG - Intergenic
1030499349 7:110339969-110339991 CCCTGAAAGCAATACACTCTGGG + Intergenic
1031947086 7:127853594-127853616 GCAGGGCAGCATTAAACCCTGGG - Intronic
1035459933 7:159032337-159032359 CCCTGCCAGCCATGAACCCCAGG - Intronic
1037804994 8:22054147-22054169 CCCTGGCAGCAAAATGACCTTGG + Intronic
1038470800 8:27817275-27817297 CCTTTGTAGCCATAAACCCTGGG - Intronic
1042097684 8:65235451-65235473 CCCTGGCAGTGATACACCGTAGG - Intergenic
1045542370 8:103099155-103099177 CCCTAGCTGCAATAGAGCCTAGG - Intergenic
1049704228 8:144032661-144032683 AACAAGCAGCAATAAACCCTGGG - Intronic
1053364887 9:37515810-37515832 CCCGGGCAGCCACAATCCCTGGG + Intronic
1053465783 9:38307309-38307331 GCCTGGCAACACTAAACACTGGG - Intergenic
1053943656 9:43280418-43280440 CCGTGGCAGGCATAAACCCAAGG + Intergenic
1054967810 9:71049647-71049669 CCCTGGAAGCAATTGACACTTGG + Intronic
1055646618 9:78367451-78367473 CCCTGGCATCAGAAAACTCTAGG + Intergenic
1055871196 9:80882033-80882055 TCCTAGCAGAAATAAACCCAGGG + Intergenic
1056252971 9:84769615-84769637 CACTGGCAGCAATAAGTCCTTGG - Intronic
1056932391 9:90889876-90889898 CACTGGCAGCACTGGACCCTGGG + Intronic
1058348451 9:103992610-103992632 CCCTGCCTTCAATAAACTCTTGG - Intergenic
1203586774 Un_KI270747v1:10321-10343 CCGTGGCAGGCATAAACCCAAGG + Intergenic
1186082279 X:5945965-5945987 CATTGGAAGAAATAAACCCTTGG - Intronic
1186091641 X:6054992-6055014 CCATGCCAGAAAAAAACCCTGGG + Intronic
1187929028 X:24277085-24277107 CCCTGGTTGCAATAAACGCTGGG - Intergenic
1190041300 X:47074463-47074485 CCCTGACAGCATTCAATCCTTGG + Intergenic
1192126942 X:68509883-68509905 CCCTGGAAGCAATAGACGCAAGG - Intronic
1192836602 X:74806233-74806255 ACCTGGCAACAATAGACACTGGG + Intronic
1196490768 X:116263126-116263148 CCCTGGCAGGAACAAACCTATGG - Intergenic
1199440943 X:147867081-147867103 CCCTGGCAGCAGTCATCACTTGG + Intergenic
1201435973 Y:13958950-13958972 GCCTGGGAGCAACACACCCTAGG - Intergenic
1201513007 Y:14786304-14786326 CATTGGAAGAAATAAACCCTCGG + Intronic
1201952344 Y:19579347-19579369 CTGTGGCAGCAGAAAACCCTAGG - Intergenic
1202197200 Y:22307901-22307923 CCCTGGCACCCCTAGACCCTAGG + Intergenic