ID: 1086917822

View in Genome Browser
Species Human (GRCh38)
Location 11:92551172-92551194
Sequence CCTCAATTACAGCAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086917816_1086917822 16 Left 1086917816 11:92551133-92551155 CCAAAGGTTAGTTAGAGACCAAT 0: 1
1: 0
2: 1
3: 4
4: 112
Right 1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG 0: 1
1: 0
2: 1
3: 10
4: 89
1086917819_1086917822 -2 Left 1086917819 11:92551151-92551173 CCAATTGGAGGTGAGCAAATACC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG 0: 1
1: 0
2: 1
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086917822 Original CRISPR CCTCAATTACAGCAGGTATC TGG Intronic
900967941 1:5972332-5972354 CCTCAAAGACAGCAGGGATCGGG + Intronic
901974008 1:12930107-12930129 CCAAAATTACAGCAGGTGCCAGG - Intronic
902011172 1:13271661-13271683 CCAAAATTACAGCAGGTGCCAGG + Intergenic
908074504 1:60500454-60500476 GCTCAATTCCAGCAGCTATCTGG + Intergenic
908877351 1:68692588-68692610 CCTCAATCACAGCCTATATCAGG + Intergenic
910355534 1:86349536-86349558 GCTCAGTTTCAGAAGGTATCAGG - Exonic
915327489 1:155087887-155087909 CCTCAATTACAGCATGGAAGGGG - Intergenic
1065564191 10:26992592-26992614 CCTCAATTAGAGCAGTTCTTTGG + Intronic
1067844796 10:49711007-49711029 CCTCGCTTACAGCAGGTAACAGG - Intergenic
1068579685 10:58725018-58725040 CCCCATTTGCAGCAGGAATCTGG + Intronic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1072786263 10:98285051-98285073 CCTCTGATACAGCAGGTATCTGG - Intergenic
1074469403 10:113713848-113713870 CTTCAATTACAAGAGCTATCTGG - Intronic
1079248279 11:18769274-18769296 CATCAATTAAAGCAGGCATCAGG - Intronic
1083109644 11:60392807-60392829 CCTGAGACACAGCAGGTATCAGG - Intronic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1097657097 12:62378993-62379015 CCTCCATGAAAGCAGGTACCAGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100085848 12:90909507-90909529 GATGAAGTACAGCAGGTATCAGG + Intronic
1103919077 12:124390106-124390128 CCTCAACCACATCAGGGATCTGG + Intronic
1104036255 12:125099056-125099078 CCTCACTGACAAAAGGTATCTGG - Intronic
1104625076 12:130345757-130345779 CCTGAAATCCAGCAGATATCTGG - Exonic
1110334511 13:74311689-74311711 TATCACTTCCAGCAGGTATCTGG + Intergenic
1118167907 14:63356301-63356323 GCTCAATCACACCAGGTATTTGG - Intergenic
1120356369 14:83439415-83439437 CTTCAATTATAGCAGGTGTAGGG + Intergenic
1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG + Intronic
1134769411 16:16794023-16794045 CATCAATTACAGCAGGTCACTGG + Intergenic
1135974340 16:27097575-27097597 CCTCTCTCACAGCAGGCATCAGG - Intergenic
1136357841 16:29757922-29757944 CATAAATTACAGCATGTATAGGG - Intergenic
1140757460 16:78080917-78080939 CCTCAATAACAGCTGCTTTCTGG - Intergenic
1140860356 16:79012764-79012786 CCTGAAACACAGCAGGTATTCGG + Intronic
1141131204 16:81438255-81438277 CCTCATTTATAACAGGAATCAGG - Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1155207065 18:23568779-23568801 CCTCTTTTACAGCTGGCATCAGG - Intronic
1157107790 18:44791140-44791162 CCTCAATTCCAGGAGATATTTGG + Intronic
1159028767 18:63209942-63209964 CACCAATTTCAGCAGGTGTCTGG - Intronic
1161212252 19:3073369-3073391 GCTTAATTACAGCATGTCTCAGG + Intergenic
1163564990 19:18045755-18045777 CCTAAAGCACAGCAGGCATCTGG + Intergenic
1165998546 19:39863260-39863282 CCTCCTGCACAGCAGGTATCAGG - Intergenic
1166020025 19:40018752-40018774 CCTCAATTACAGCTGTAATCAGG - Intergenic
926421065 2:12700020-12700042 CCTCAATTACACTAGATCTCTGG + Intergenic
927711272 2:25327903-25327925 CCTCACATCCAGCAGGTACCTGG + Intronic
938834062 2:135081557-135081579 TCTCAATTCCAACAGATATCTGG - Intronic
939933789 2:148263454-148263476 CCTTAATTTCAGCAGGAAACAGG - Intronic
942654857 2:178204678-178204700 CCTCACTTTCAACAGATATCTGG - Intronic
945041872 2:205749234-205749256 CCTCACTTACAGTAGGTGTTTGG + Intronic
946078626 2:217097175-217097197 CCTCAATCACTGCAGGCTTCTGG - Intergenic
948339942 2:237241548-237241570 ACCCAACTACAGCAGGCATCAGG - Intergenic
1169282195 20:4277347-4277369 CCTCACTCACAGCAGGTCTCAGG - Intergenic
1173961893 20:47080389-47080411 ACACAATTACCACAGGTATCAGG + Intronic
1174236181 20:49094174-49094196 CCTGAAATTCAGAAGGTATCTGG + Exonic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1179201461 21:39226439-39226461 ACTAAATTACAGGAGGCATCTGG + Intronic
1184451948 22:44587832-44587854 CGTCATTTGCAGCATGTATCAGG - Intergenic
1185394540 22:50579966-50579988 ACTCAAGAACAGCAGGTATGTGG - Exonic
950663681 3:14482278-14482300 CCTCAATAAAAGAAGGCATCTGG - Intronic
954631334 3:52049347-52049369 CCTCAGTTCCACCAGGTGTCAGG - Exonic
955697442 3:61651100-61651122 CCTCAATTACACGATGTATTTGG + Intronic
956097276 3:65730396-65730418 CCTCATTTAAAGCAGGAAGCAGG + Intronic
961673759 3:128552557-128552579 CCCCAATTACAGCAGAGGTCTGG + Intergenic
964662515 3:159136005-159136027 CCTCACTTACAGAAGGGATCAGG + Intronic
966084136 3:176046760-176046782 CATCAATTACAGTAGGCAGCAGG - Intergenic
967901073 3:194452793-194452815 GCTCATTTACTGTAGGTATCAGG - Intronic
968982671 4:3858956-3858978 CCTAATGTACAGCAGGTACCGGG - Intergenic
969148632 4:5146809-5146831 TCTTAATTACTGCAGGTTTCTGG + Intronic
980126438 4:128778920-128778942 CCTCAATTGAAGCCTGTATCTGG + Intergenic
980136576 4:128863794-128863816 CCCCAATTACAGCAGGTGTCGGG - Intronic
980830484 4:138125197-138125219 TCTCAATTAAAGCAGTTATTTGG + Intergenic
984911946 4:184681973-184681995 CCTTAATTACAGAATGGATCAGG - Intronic
990785100 5:59409786-59409808 CCTCAATTACCCCATGTATTAGG - Intronic
992332247 5:75729298-75729320 CTTCAATTACAGCAGCTTTGAGG - Intergenic
993755138 5:91719891-91719913 CCTCAACTCCAGCAGATGTCTGG + Intergenic
994315675 5:98330410-98330432 CCTAAAATACAGAAGGCATCCGG + Intergenic
994617584 5:102125199-102125221 CTTCAAAAACAGCAGGAATCAGG - Intergenic
999334456 5:150703579-150703601 CCTCAATTAAAGCAATTCTCTGG + Intergenic
999479526 5:151934427-151934449 GTTCAGTTACAGCAGGTAGCTGG + Intergenic
999658762 5:153836261-153836283 CATCAATGACAGCAGGCTTCAGG + Intergenic
1002932000 6:1641180-1641202 CCTGAATGACAGCATGTCTCAGG - Intronic
1004494687 6:16152687-16152709 CTACAATCAAAGCAGGTATCAGG + Intergenic
1006616414 6:35330722-35330744 TCTCAACAACAGGAGGTATCAGG - Intergenic
1007121058 6:39381890-39381912 TCTGAATTACAGCAGGTGTTAGG - Intronic
1007497827 6:42273254-42273276 TCTCTATTAGAGCAGGAATCAGG + Intronic
1008786208 6:55171696-55171718 CATAAAATAAAGCAGGTATCAGG + Intronic
1011157657 6:84351118-84351140 CCTAAATCGCAGCAAGTATCTGG - Intergenic
1012255290 6:97024289-97024311 ACTCTATTACAGCAGCTATGTGG - Intronic
1018837970 6:167499310-167499332 TTCCAATTTCAGCAGGTATCTGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1030245802 7:107383646-107383668 CCTCACGTACCCCAGGTATCTGG + Intronic
1030719612 7:112854938-112854960 TCTCAATAAGAGCAGGAATCTGG - Intronic
1037658941 8:20910831-20910853 CCCCAATGACAGCAGGCAGCAGG + Intergenic
1041669766 8:60480370-60480392 CATGAATGGCAGCAGGTATCTGG + Intergenic
1042242926 8:66682641-66682663 CCTCACTTACAGGAAGGATCAGG - Intronic
1048153979 8:131924030-131924052 CAGCAATTACAGTAAGTATCAGG - Intronic
1056280514 9:85037406-85037428 CCTCATTTCCAGCAAGTATGGGG - Intergenic
1060817986 9:126645390-126645412 CCTGAAGTACAGCAGGGATTTGG - Intronic
1191714462 X:64184783-64184805 CCTCAATTTCTGCAAGTATGTGG - Intergenic
1195018182 X:100799012-100799034 CCTCAATTAAAGCAATTCTCTGG - Intergenic
1195398453 X:104436346-104436368 CCTTAATTACAACTCGTATCAGG + Intergenic
1195995585 X:110728732-110728754 CCTCCATTACAGCAGTGCTCTGG - Intronic
1196276010 X:113766152-113766174 CCTCATTGGCAGCAGGTACCTGG + Intergenic
1196781755 X:119389919-119389941 TTTCAATTACAGCAGGGATGGGG - Intergenic