ID: 1086919773

View in Genome Browser
Species Human (GRCh38)
Location 11:92573232-92573254
Sequence GTGCCGTGGGATGACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086919769_1086919773 7 Left 1086919769 11:92573202-92573224 CCATCTTGGGTAATAAATACTTA 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1086919773 11:92573232-92573254 GTGCCGTGGGATGACCCTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086919773 Original CRISPR GTGCCGTGGGATGACCCTGA AGG Intronic
900292533 1:1929607-1929629 GGGCCTTCGGGTGACCCTGAGGG - Intronic
903128601 1:21263844-21263866 GTGCCGTGGGTTGTCCCCGTGGG - Intronic
903377498 1:22876079-22876101 GTGCAGTGGGAAGCCGCTGAGGG + Intronic
904035574 1:27556977-27556999 GTGCTGTGGGGGGGCCCTGATGG - Intronic
906186654 1:43867220-43867242 GTGTCGTGGGAGGAACCTGATGG - Intronic
908426779 1:64015211-64015233 GTGACGTGGGAGGAACCTGGTGG - Intronic
911500444 1:98679314-98679336 GTGTTGTGGGATGAACCTGGTGG - Intronic
913018693 1:114764925-114764947 ATGTCGTGGGAGGAACCTGATGG + Intergenic
913451895 1:118998265-118998287 GGGCCCTGGGAGGCCCCTGAGGG + Intergenic
915233235 1:154461715-154461737 GTGCCGAGGCAAGACACTGAAGG - Intronic
915474398 1:156144847-156144869 GTGCTTTGGGAAGACACTGAGGG - Intergenic
915654996 1:157352101-157352123 GTGTCGTGGGAAGAACCTGGTGG - Intergenic
918264923 1:182832901-182832923 GTGCCATGGGAGGGACCTGATGG - Intergenic
919141959 1:193583600-193583622 GTGTCGTGGGAGGGACCTGATGG - Intergenic
919545458 1:198912019-198912041 GTGCTGTGGGAGGGACCTGATGG - Intergenic
922646417 1:227291219-227291241 GTGCCATCTGATAACCCTGAGGG + Intronic
1063428974 10:5972205-5972227 GTGCAGTGGGGAGTCCCTGAGGG - Intronic
1069996339 10:72344350-72344372 GAGCTGTGGCATGACCCTGGGGG + Intronic
1070824199 10:79381322-79381344 GGGCCGTGGGATGGCCCATAGGG + Intergenic
1071061043 10:81570992-81571014 GAGCCCTGGGCTGCCCCTGAAGG - Intergenic
1073129214 10:101175926-101175948 GTGCCTTTGGATGAACCTGTTGG + Intergenic
1075565333 10:123499395-123499417 GTGCTGTGGGAAGAACCTGGTGG + Intergenic
1075638413 10:124046506-124046528 GTGCCATGGGAAAAACCTGAAGG - Exonic
1078324375 11:10367704-10367726 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1079703897 11:23588832-23588854 GAGAAGTGGGATGACCCTGCTGG + Intergenic
1083271080 11:61572982-61573004 TTGCCTTGGGATGACCCCCAAGG + Intronic
1083545146 11:63543851-63543873 CTGCACTGGGCTGACCCTGAGGG - Intronic
1086142036 11:83510131-83510153 GTTAAGTGAGATGACCCTGATGG + Intronic
1086816138 11:91373578-91373600 GTGTCGTGGGAGGAACCTGTTGG + Intergenic
1086919773 11:92573232-92573254 GTGCCGTGGGATGACCCTGAAGG + Intronic
1088001164 11:104882721-104882743 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1089015174 11:115159582-115159604 GTGCCTTGGGCTGTCCCTGAAGG + Intergenic
1091315432 11:134610927-134610949 GGGCCCTGGGTTGAACCTGAGGG - Intergenic
1093837684 12:23856165-23856187 GTGCTGTGGGATGGTCCTTATGG - Intronic
1096214830 12:49793099-49793121 GTGCTGTGGAATGAGCCTGTTGG - Intronic
1097245799 12:57607052-57607074 GGGCCGGGGGAGGACCCTGTGGG - Exonic
1099802339 12:87473279-87473301 GTGCTGTGGGAGGAATCTGATGG + Intergenic
1101763359 12:107677286-107677308 GTGCTGTGGGAGGAACCTGGCGG - Intergenic
1103821557 12:123702681-123702703 AGGCTGTGGAATGACCCTGAGGG + Intronic
1105673110 13:22642395-22642417 GTGCCCTGGGTTGACCATGGAGG + Intergenic
1107344116 13:39440787-39440809 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1108258539 13:48633481-48633503 GTGCTGAGGCATGACCCAGAAGG + Intergenic
1108609517 13:52070426-52070448 GTGTTGTGGGGTGACCCAGAGGG + Intronic
1108778474 13:53797031-53797053 GTGCCATGGGAGGAACCTGGTGG - Intergenic
1110008665 13:70304894-70304916 GTGTCATGGGATGATCCTGGTGG + Intergenic
1110163084 13:72402657-72402679 GTGTCGTGGGAGGAACCTGATGG - Intergenic
1113994670 14:16056314-16056336 GGGCAGTGGGCTGACCCGGAGGG - Intergenic
1118866947 14:69711583-69711605 TTGCCCTGGGTTGACCCTGGTGG + Exonic
1119975932 14:79023805-79023827 GTGTTGTGGGAGGAACCTGATGG - Intronic
1120684083 14:87517691-87517713 GTGTCGTGGGAGGAGCCTGGTGG - Intergenic
1120956597 14:90088763-90088785 GTGTCATGGGAGGAACCTGATGG + Intronic
1121087224 14:91155849-91155871 GTGCCTTGGGGTGGCCCTGATGG - Intronic
1124835672 15:33194352-33194374 GAGCGTTGGGATGACCCGGAGGG + Intronic
1125719663 15:41839262-41839284 GGGCCCTGGGCTGACCCTGGTGG + Intronic
1128718329 15:69926780-69926802 TGGCCATGGGTTGACCCTGAGGG + Intergenic
1134374690 16:13660942-13660964 GTGTCGAGGGAGGAACCTGATGG + Intergenic
1135684463 16:24487343-24487365 GTGTCCTGGGATGACCTGGATGG + Intergenic
1149062814 17:52443672-52443694 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1149216343 17:54358652-54358674 GTGCCATGGGAGGAACCTGGTGG - Intergenic
1152773164 17:82183070-82183092 GTGTCAAGGGAGGACCCTGATGG - Intronic
1152879486 17:82807058-82807080 CAGCCCTGGGAAGACCCTGATGG - Intronic
1155772671 18:29722466-29722488 GTGCTGTGGGAGGAGCCTGGTGG - Intergenic
1157210908 18:45741103-45741125 GTGCGGTGGGATAACTCTGGAGG - Intronic
1159717806 18:71848120-71848142 GTGCTGTGGGAGGAGCCTGGTGG + Intergenic
1160516098 18:79480032-79480054 GTGGCCTGGGCTGACCCTGCAGG - Intronic
1164593253 19:29517667-29517689 GTGCCCTGGGGTGGCTCTGAAGG - Intergenic
1164858875 19:31546842-31546864 GTGCCTTGGTCTGACCCTGTTGG - Intergenic
1164899116 19:31903212-31903234 GTCCCATGGAATGACCCAGAAGG - Intergenic
1165522842 19:36328166-36328188 GAGACATGGGATGACCCTAAGGG + Intergenic
1167244658 19:48365716-48365738 CTGCTGTGGGATGACACAGATGG - Exonic
927409142 2:22805399-22805421 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
932394429 2:71431407-71431429 GTGGCGTCTGATGTCCCTGAGGG + Exonic
934040312 2:88122707-88122729 GTGCAGTGGGCTGGCCTTGAGGG - Intergenic
935691948 2:105740198-105740220 GGGACGTGGGAGGACCCTGTAGG - Intergenic
936520809 2:113210934-113210956 GAGGCCTGGGATGACCATGAGGG + Intergenic
938106676 2:128536237-128536259 GGGCCGGGGGATGATCCTTAAGG - Intergenic
938241635 2:129746907-129746929 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
945643396 2:212459963-212459985 GTGTTGTGGGAGGAACCTGATGG + Intronic
946562371 2:220927511-220927533 GTGTTGTGGGAGGAACCTGATGG - Intergenic
946897830 2:224342667-224342689 GTGCTATTGGATGACCATGAGGG + Intergenic
946968774 2:225068501-225068523 ATGCTGTGGGATGAACCTGATGG + Intergenic
947886663 2:233577546-233577568 GTGGCGTGGGAGGAACCTGGAGG - Intergenic
948894440 2:240921737-240921759 GTGGCGTTGGAAGACCCTGGAGG - Intronic
1169540073 20:6590458-6590480 GTGTTGTGGGAGGAACCTGATGG + Intergenic
1172207831 20:33176932-33176954 GAGCCCTGGGAAGGCCCTGAAGG - Intronic
1172720028 20:36992838-36992860 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1173252654 20:41372754-41372776 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1173295319 20:41750257-41750279 CTCCCCTGGGAGGACCCTGACGG - Intergenic
1175353831 20:58346305-58346327 GTGCAGTGGGAAGTCACTGAAGG - Intronic
1175709295 20:61206320-61206342 GTGCCATGTGGTGGCCCTGATGG - Intergenic
1177114626 21:17071083-17071105 GTGTCGTGGGAGGGACCTGATGG - Intergenic
1178122438 21:29482710-29482732 CTGCCTTGGGAGGCCCCTGAAGG - Intronic
1178701061 21:34834489-34834511 GTGGTGTGGGCTGACCCTCATGG + Exonic
1179181351 21:39047789-39047811 GTGCTGTGGGAGGGACCTGATGG - Intergenic
1180312422 22:11251095-11251117 GGGCAGTGGGCTGACCCGGAGGG + Intergenic
1182037916 22:27213880-27213902 GTGACGTGGAATGAACCTGCAGG + Intergenic
1182679420 22:32067138-32067160 GCACCCTGGGGTGACCCTGAAGG - Intronic
1183649262 22:39144995-39145017 GTGGCCTGGGAGGAGCCTGAAGG - Intronic
1184929677 22:47671867-47671889 GTGCCGTGGGCTGTCCCTTGGGG - Intergenic
952652028 3:35738413-35738435 GTGCCCTGGGCTGACTGTGAGGG + Intronic
954038972 3:47869965-47869987 GTGCTGTTGGAAGACACTGATGG - Intronic
958763719 3:98339969-98339991 GTGTTGTGGGAGGAACCTGATGG + Intergenic
959575559 3:107929199-107929221 GTGCCATGGGAAGGCACTGAAGG - Intergenic
960473054 3:118092100-118092122 GTGTCATGGGAAGAACCTGATGG + Intergenic
961171557 3:124801152-124801174 GTGCTGTGGGAAGCCCATGACGG + Intronic
961210765 3:125123729-125123751 GTGTCGTGGGAGGAACCTGGTGG - Intronic
961486900 3:127222984-127223006 GTGCTGTGGGCTGCCCCTGGAGG - Intergenic
964513411 3:157478205-157478227 TTGTCGTAGGATGACTCTGAAGG + Intronic
966228845 3:177628405-177628427 GTGCCCTGGGAGGAACCTGGTGG - Intergenic
966792630 3:183687755-183687777 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
967418487 3:189246073-189246095 GTGTCGTGGGAGGGACCTGATGG + Intronic
970344167 4:15137102-15137124 GTGTCATGGGAGGATCCTGATGG - Intergenic
970357536 4:15270355-15270377 ATGCTGTGGGAGGAACCTGATGG + Intergenic
973064008 4:45764626-45764648 GTGTCATGGGAGGAACCTGATGG - Intergenic
973094360 4:46178605-46178627 GTGTCATGGGAAGAACCTGATGG + Intergenic
974477970 4:62407232-62407254 GTGTCGTGGGAGGATCCTGGTGG + Intergenic
980727976 4:136788716-136788738 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
980901606 4:138910633-138910655 GTGCCGTGGGCTGCACCTGCCGG + Intergenic
983877332 4:172892847-172892869 TTGCCTTGGGCTGCCCCTGAGGG - Intronic
985760483 5:1746311-1746333 GGGCCCTGGCAGGACCCTGAGGG + Intergenic
990430553 5:55731001-55731023 GTACCATGGCATAACCCTGAGGG - Intronic
992075877 5:73192203-73192225 GTGCTGTGGGAGGAACCTGGTGG + Intergenic
995089201 5:108152923-108152945 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1002300344 5:178254256-178254278 GTGGCGTGGCATGGCCCAGACGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004747168 6:18522614-18522636 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1010735734 6:79442354-79442376 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
1012008955 6:93755166-93755188 GTACCGTGGAATTACCCTGAAGG - Intergenic
1013465048 6:110410726-110410748 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1013935226 6:115586301-115586323 GTGCTGTGGGAGGAACCTGGTGG + Intergenic
1014182717 6:118403094-118403116 CCGCCATGGGATAACCCTGAAGG - Intergenic
1015753462 6:136584604-136584626 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1019428186 7:987101-987123 CTGCAGGGGGATGACCCCGAGGG + Exonic
1019454912 7:1121985-1122007 GTGCCGTGTAAGGACCATGAGGG - Intronic
1019626988 7:2021076-2021098 GAACAGTGGGATGACCGTGAAGG + Intronic
1020869428 7:13608464-13608486 ATGCTGTGGGAGGAACCTGATGG + Intergenic
1023422434 7:39995954-39995976 GTGCAGTGGCATGATCCAGACGG - Intronic
1025279323 7:57615455-57615477 GATCCGGGGGAGGACCCTGAGGG - Intergenic
1025305408 7:57850045-57850067 GATCCGGGGGAGGACCCTGAGGG + Intergenic
1027605234 7:80291887-80291909 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
1030267466 7:107635017-107635039 GTGTTGTGGGAGGAACCTGATGG + Intergenic
1034292050 7:149940745-149940767 GGGCCTCGGGATGACCCTGTAGG + Intergenic
1034814027 7:154156152-154156174 GGGCCTCGGGATGACCCTGTAGG - Intronic
1035070764 7:156143654-156143676 GTGCAGTGAGAGGTCCCTGAAGG - Intergenic
1035454769 7:159000871-159000893 GAGCCCTGCGATGGCCCTGATGG + Intergenic
1036814380 8:11890342-11890364 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1037313477 8:17579433-17579455 GTGCTTTGGGATGGCCTTGAAGG - Intronic
1037490713 8:19394649-19394671 AGGCTGTAGGATGACCCTGATGG - Exonic
1038848497 8:31251862-31251884 GTGCTGTGGGAGGAACCCGATGG - Intergenic
1047565711 8:126041309-126041331 GTGTCGTGGGAGGAACCTGATGG + Intergenic
1049733186 8:144189591-144189613 TGGCCTTGGGCTGACCCTGAGGG - Intronic
1051355829 9:16239103-16239125 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1052716707 9:32126761-32126783 GTGCTGTGGGAGGAACCTGGTGG - Intergenic
1053341931 9:37344337-37344359 GTGGCATGGGATGCCCATGATGG - Intronic
1055976139 9:81956820-81956842 GTGTTGTGGGAGGGCCCTGATGG - Intergenic
1059449180 9:114359635-114359657 CTGCCTTGGGAGGACCCTGGTGG + Exonic
1061786156 9:133029987-133030009 GTGCCGTGGAGAGCCCCTGAAGG - Intergenic
1061989972 9:134153551-134153573 GTGACGTGGTGTGCCCCTGAGGG + Intronic
1062639455 9:137510830-137510852 GTGCCGAGGCATGAGACTGAAGG + Intronic
1185645199 X:1610783-1610805 GTTCCGTGCAATGTCCCTGAGGG + Intergenic
1193167804 X:78302061-78302083 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1193336736 X:80298548-80298570 GTGCATTGGGAAGACACTGAAGG + Intergenic
1196826115 X:119741563-119741585 GTGTCGTGGGAAGAACCTGGTGG + Intergenic