ID: 1086920041

View in Genome Browser
Species Human (GRCh38)
Location 11:92575804-92575826
Sequence GTTAATAGGCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086920041 Original CRISPR GTTAATAGGCAGAAGGAGGA AGG Intronic
900850949 1:5142685-5142707 GTTAAAAGGCAGCAGAGGGAGGG - Intergenic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901452483 1:9344565-9344587 GTTGAGAGGCGGCAGGAGGAGGG + Intronic
901609981 1:10490334-10490356 GTTACTGGGCAGATGCAGGATGG + Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902163605 1:14552220-14552242 ATTAATAGGGGGCAGGAGGATGG - Intergenic
902873741 1:19328883-19328905 GTGAGTAGGCAGAATGAGGTAGG - Exonic
903459712 1:23512084-23512106 GTTAATAGGGAGGCTGAGGAAGG + Intronic
904009566 1:27382155-27382177 GGAAATAGGCAGAGAGAGGAGGG + Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904827641 1:33284642-33284664 GTTAGTTGGAAGAAGGAAGAAGG + Intronic
904870971 1:33617948-33617970 GTTAAGAGTAAGAAGCAGGAGGG - Intronic
904936932 1:34137555-34137577 GTTCAAAGGCAGAAGGGTGAAGG - Intronic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906154643 1:43606746-43606768 ATTAATAGGCAGAGGGTGGGGGG + Intronic
906155249 1:43610119-43610141 GTCAAAAGGAAGAAGGAGGGAGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
907588944 1:55647316-55647338 GCTTATAGTGAGAAGGAGGAAGG - Intergenic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908895782 1:68897019-68897041 GCTACTAGGCAGACGGAGGTGGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
910062134 1:83106535-83106557 GTTAGGGGGCAGAAGAAGGAGGG + Intergenic
911548517 1:99251147-99251169 GTCAATAGGCAGCAGGTGGTTGG + Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912073701 1:105845979-105846001 GTTAACTGGAAGAAGAAGGAAGG + Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
915250650 1:154585915-154585937 GTTAAGAGGCAGAAGCATGTGGG + Intronic
917691715 1:177476727-177476749 GTAAATGGGGAAAAGGAGGAGGG + Intergenic
918247859 1:182675643-182675665 GTTAATAGGCAGATCAAGGGTGG - Intronic
919795302 1:201318013-201318035 GTTAAAGAGCAAAAGGAGGAAGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921379746 1:214512316-214512338 GTTAGGAGGCAGAAGGAGTGAGG - Intronic
922618994 1:226979314-226979336 GTTCACAGGCAGAAGGCGGCAGG - Intronic
922819556 1:228474681-228474703 GTTAAGAGGCAGATGGAGGGAGG + Intergenic
923134140 1:231102850-231102872 GTTAATAGGCAGGAGGTTGGAGG - Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1065645214 10:27826771-27826793 GTTAATTGGCAAGAGCAGGAAGG - Intronic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066083380 10:31954387-31954409 GGTAACAGGCAGAAGTTGGAGGG + Intergenic
1066435266 10:35391803-35391825 GATAACAGGAAGAGGGAGGAGGG - Intronic
1067682211 10:48448331-48448353 GTTAAAAGGGAGATGAAGGAGGG - Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1068096995 10:52503918-52503940 GTTAATAGGAAGTAGGTGGTTGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1074839129 10:117330619-117330641 TTTAATAGGAACAAGAAGGAAGG - Intronic
1075350460 10:121720103-121720125 GTTAATGGGCTGAGGGTGGAAGG - Intergenic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1077031262 11:468988-469010 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031271 11:469020-469042 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031298 11:469116-469138 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031307 11:469148-469170 GGTAATTGGAAGGAGGAGGAGGG + Intronic
1077031331 11:469244-469266 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1078409147 11:11097400-11097422 ATTACTAGGCAGGAGGATGAAGG - Intergenic
1078746282 11:14118665-14118687 GATAATGGGGAGAAGTAGGATGG - Intronic
1079739347 11:24037464-24037486 GTCAGTAGGCTGAATGAGGAAGG + Intergenic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1079997744 11:27313500-27313522 GTGCATAGGCAGAAGGAAGGAGG + Intergenic
1080316481 11:30955812-30955834 GTTAATACAGAGAAGGAGAAGGG - Intronic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1085045496 11:73350628-73350650 GTTAGGAGCCAGAAGGAGGGAGG + Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085244301 11:75086838-75086860 ATTAATAGGCAGAACACGGAGGG - Intergenic
1085596245 11:77813077-77813099 GTTAATAAACAGAAGAAGCAGGG - Intronic
1085930661 11:81079092-81079114 GATAAATGGCAGAAGTAGGATGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1088675817 11:112192078-112192100 GTTAACAGGAGGAAGCAGGAAGG - Intronic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089100093 11:115955720-115955742 TTTCTTAGGGAGAAGGAGGAGGG - Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090728351 11:129547756-129547778 GGTAATGGGCAGAAGTTGGAAGG + Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1092282225 12:7106906-7106928 GTAAACTGGCAGAATGAGGAGGG + Intronic
1092384979 12:8029316-8029338 GTTAAATGCCTGAAGGAGGAAGG - Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093111792 12:15161471-15161493 GTAAATGGGAAGAAGGAGGAAGG - Intronic
1094700820 12:32869099-32869121 GTTGGTAGGCAGGAGGAGGGAGG - Intronic
1095128241 12:38507855-38507877 GTTAATATGCAAAAGTAGAAAGG + Intergenic
1097401729 12:59135620-59135642 GTTAATGGGCAGAGGTTGGAGGG - Intergenic
1097768549 12:63553237-63553259 GGTAATAGCCAGACAGAGGAGGG + Intergenic
1097784909 12:63748279-63748301 CGTAATAGCCAGACGGAGGAGGG + Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098698371 12:73589736-73589758 GTTAATAGGTAGAAACAGGGTGG - Intergenic
1098734101 12:74075934-74075956 GTTAATAGGCAAAAAAAAGAAGG + Intergenic
1098854013 12:75631761-75631783 GGTAAAAGGCAGAAGGGTGAGGG + Intergenic
1099334990 12:81344153-81344175 GTCAGGAGGCAGAAGGAGCAGGG - Intronic
1100060352 12:90567241-90567263 GTAAATTGGTACAAGGAGGAGGG - Intergenic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100901373 12:99244767-99244789 GTTCTTAGGCAGAAGAAGAAGGG - Intronic
1101031389 12:100663996-100664018 ATTCATAGGCAGAAGAAAGATGG + Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103959988 12:124603422-124603444 GGTAAGAGGCAGACGGAGAAGGG - Intergenic
1104092690 12:125529034-125529056 GGAAAAAGGAAGAAGGAGGAGGG - Intronic
1105991820 13:25629715-25629737 GTAAAAAGGCAGAGGGTGGAAGG - Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108986062 13:56589551-56589573 GTTAATAGGGAGGTGGAGGTGGG - Intergenic
1109567616 13:64138168-64138190 GTTAAAAAGCAGAAGGATGAAGG + Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1110417237 13:75267014-75267036 GCCAATAGTCAGAAGGAAGAGGG + Intergenic
1111584140 13:90262257-90262279 GGTAATAGGCAGAGGCTGGAAGG - Intergenic
1111604586 13:90520588-90520610 GCTAGGAGGCAGTAGGAGGAGGG - Intergenic
1111975205 13:94959758-94959780 GGTAATGGGGAAAAGGAGGACGG - Intergenic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112782624 13:102917333-102917355 GTAAATAGGAAGATGAAGGAAGG - Intergenic
1113282121 13:108799860-108799882 GTTAAGAGGAAGAAGAAGGGAGG + Intronic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1115576930 14:34720380-34720402 TTTACTAGGCAGATGAAGGAAGG + Intergenic
1118094159 14:62517706-62517728 GTTAATATAAAGAAGGGGGAAGG - Intergenic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1120401607 14:84039569-84039591 GTTAATAGGAAGAAGATAGAAGG + Intergenic
1121637720 14:95465165-95465187 ATTAAAGGGCAGGAGGAGGAAGG + Intronic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1126893588 15:53233936-53233958 GATATTAGGCAGGAGGAGGGGGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1129919569 15:79309012-79309034 GGAACTAGGCAGAAGGAGCAAGG - Intergenic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1130227839 15:82073305-82073327 GTTCCTGGGCAGAAGGAGGTGGG - Intergenic
1130307203 15:82721275-82721297 GTTGAAAGGCAGAAGGAAAAGGG - Intergenic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1131852121 15:96554632-96554654 GTAAAAAGGAAGGAGGAGGAGGG - Intergenic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1134829981 16:17315099-17315121 GGGAAAAGGCAGAAGGAGGGAGG + Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1139027835 16:62840797-62840819 GTTGATAGGAAGTAGAAGGATGG - Intergenic
1139567792 16:67790278-67790300 GTTAACAGGGACTAGGAGGAAGG + Intronic
1139763421 16:69206294-69206316 GCTAAAAGGTAGAAGGAGGCAGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143919843 17:10322446-10322468 GTTATCAGGAAGCAGGAGGAGGG + Intronic
1144467713 17:15509544-15509566 GTTAATAGGCAGAGGAAGGATGG - Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147467078 17:40618500-40618522 GTTACTAGGGAGAATGAGGCAGG + Intergenic
1147946815 17:44084989-44085011 GTTGAGAGCCAGAAGAAGGAGGG + Intronic
1147998066 17:44372196-44372218 TTTATTAGGCAGCAGGAGGGGGG + Exonic
1148513579 17:48194748-48194770 ATTAAAAGGAAGAGGGAGGATGG - Intronic
1148645958 17:49219815-49219837 GGTATTAGGAGGAAGGAGGAAGG - Intronic
1149071829 17:52552588-52552610 GTTAGTAGACAGAAGCAAGAAGG - Intergenic
1149900892 17:60477120-60477142 GTTAATAGGCAGTAAGAAGAGGG - Intronic
1151052601 17:70995603-70995625 GTCAGGAGGCAGAAGGAGTAGGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1154507923 18:15060881-15060903 GTTCATGGGCAGAAGGGGGCAGG + Intergenic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1155687626 18:28574795-28574817 GATAATAGGCAGATAGAGGCAGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156460362 18:37318279-37318301 GATAAGCGGCAGGAGGAGGAGGG - Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1157447756 18:47758126-47758148 GTTACTAGGCATAAGAAGAAGGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158814849 18:61083490-61083512 GTTAACAGGCACATGGTGGAAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163511387 19:17737395-17737417 GTTAAAAGGCAAAAGGTGGCTGG + Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166368403 19:42288781-42288803 GGTACTAGGCAGAAGCAGGCTGG - Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1168076264 19:53982347-53982369 GTAACTGGGCAGACGGAGGATGG - Exonic
1168387415 19:55976224-55976246 TTTAATAGCCTGAAGGATGATGG + Exonic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
930784928 2:55262413-55262435 TTTAATAGGAAGAAGGACCATGG - Exonic
930854684 2:56001326-56001348 ATTATTAGGCAGAAGAAAGATGG - Intergenic
931500038 2:62855451-62855473 GTTCCTGGGTAGAAGGAGGAAGG + Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
933870342 2:86559798-86559820 ATTCATAGGCAGGAAGAGGATGG + Intronic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
935403400 2:102683696-102683718 GATAATAGGGAAGAGGAGGAAGG - Intronic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
941400622 2:165026168-165026190 GTTATTAGGCAGAAGAAGGGTGG + Intergenic
941562441 2:167064665-167064687 GTCAAGAGGCACAAGGAGAATGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
945875382 2:215272632-215272654 GATAATAGGCAAAATGAAGATGG + Intergenic
946749728 2:222881854-222881876 TTTAACAGGCATAAGTAGGAGGG - Intronic
946764781 2:223030423-223030445 GTTAATAGGTAGAAAGAGAGAGG + Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169894736 20:10490792-10490814 GTTCACAGGGAGAAGGAGAATGG - Intronic
1170766359 20:19292668-19292690 GTTGAGAGGCAGAAGCAGGTGGG + Intronic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1172108717 20:32532627-32532649 GGTACCAGGCAGAAGGGGGATGG - Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1175227349 20:57452347-57452369 GGTAAAGGGCAGGAGGAGGATGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175935202 20:62510839-62510861 GTTAATCAGCAGAAGGATGGAGG - Intergenic
1176790160 21:13310918-13310940 GTTCATGGGCAGAAGGGGGCAGG - Intergenic
1176989528 21:15478573-15478595 ATTACTAGGCAGAAGCAGTATGG + Intergenic
1182069678 22:27454834-27454856 GTTCAGAGGCAGAAGGAGTGTGG - Intergenic
1182098362 22:27640936-27640958 GTTAATAGGGGGCAGGGGGAGGG - Intergenic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
949459542 3:4275431-4275453 GTCAAGAGGCAGAAGAGGGATGG + Intronic
950432016 3:12956210-12956232 GTCAATAGGCAGGAAGAGAAGGG - Intronic
951562480 3:23982283-23982305 GTTCCTGGGCAGAAGGAGGCGGG - Intergenic
952582893 3:34855425-34855447 GTCAAGAGGCAGAGGGAGAAAGG + Intergenic
953839253 3:46375553-46375575 GTCAATAGGCAAAGGGGGGAAGG + Exonic
956159538 3:66334656-66334678 GTCAAAAGGCAGAAGCAAGAGGG - Intronic
959441894 3:106386811-106386833 GTAAATAGTTAAAAGGAGGATGG - Intergenic
960106771 3:113806361-113806383 GTTAATAGGCACTTGGAGTAAGG - Intronic
960593362 3:119386721-119386743 GATACAAGGCAGAAGGAGCAGGG + Intronic
960648997 3:119925215-119925237 GTTACTTGGGAGAAGGAGGTGGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961201488 3:125049180-125049202 GTTAAAAGGCAGAGGGAGACTGG - Intronic
962825457 3:139096401-139096423 GTCACTAGGCAGAAGGTAGAAGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
968191068 3:196667768-196667790 GTTGCTTGGCTGAAGGAGGAAGG - Intronic
968693472 4:2008625-2008647 GTTAACAGTCTGAAGGGGGATGG + Intronic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970261209 4:14227014-14227036 GTTAGAAGGCAGAGGGAGGGGGG - Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
970894711 4:21088673-21088695 GTTAATAGGAAGAAGGAGTAGGG - Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971421774 4:26480535-26480557 GTTAAGTGGCAGAAGGTGCATGG - Intergenic
972238180 4:37158364-37158386 GTCATGAGGCAGAAGGAGCAAGG + Intergenic
972551334 4:40137717-40137739 GTCAGGAGGCAGAAGGAGTAGGG + Intronic
973662095 4:53118774-53118796 GTTAAAAGGCAGAAGCAGGGAGG - Intronic
976463683 4:85343318-85343340 GTTAATATTCAAAAGGAGAAAGG - Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
978780970 4:112553576-112553598 GTAAACAGGGAGAAGGAGAAAGG + Intronic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
980941041 4:139274355-139274377 TTTAATAGGGGAAAGGAGGAGGG + Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
983357750 4:166685538-166685560 GGTAAAAGGCAGTAGGAGGATGG - Intergenic
984850306 4:184146867-184146889 GTTAGTAACCAGATGGAGGAGGG - Intronic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
988714101 5:33807821-33807843 GTTAATAGGCAAAAAGAAGCAGG + Intronic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
990879555 5:60524116-60524138 GTTATTGGGCAGCAGGAGGTGGG - Intergenic
991599578 5:68339200-68339222 GGGAATTGGCAGAAGCAGGATGG + Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992643913 5:78794601-78794623 GGTGATAGGAAGGAGGAGGAGGG + Intronic
993509669 5:88755920-88755942 GATAATAGTCAGAGGAAGGAAGG - Intronic
993844815 5:92927915-92927937 GTTAATAGGCAGAAAGAGATTGG + Intergenic
993984055 5:94575556-94575578 GTTAAGAGGCAAAAGGATGGTGG + Intronic
995366535 5:111367801-111367823 GTCCATAGGAAGAAGGAAGAAGG - Intronic
996435498 5:123429237-123429259 GTTGATTGGCAGAAGGAGATTGG + Intergenic
996692587 5:126356411-126356433 TTTAATAGGGAGAAGTAAGAGGG + Intergenic
998041770 5:138955048-138955070 GTCCATAGGCTGGAGGAGGATGG - Intronic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999676127 5:154004726-154004748 GGTAATAGGGAGGAGGAAGACGG - Intronic
1000901702 5:166919120-166919142 GTTAACAGGTTAAAGGAGGAAGG + Intergenic
1003120854 6:3318155-3318177 GTTAATAGGCAGCAGCCGCAGGG - Intronic
1003170547 6:3718683-3718705 GTCAGGAGGCAGAAGGAGCAGGG - Intergenic
1003573493 6:7271292-7271314 GTTAAGAGGCAGGAGGATGGAGG + Intronic
1004010564 6:11681998-11682020 GTTAGCAGGCAGAGGGAGCAGGG + Intergenic
1004329472 6:14708389-14708411 ATTAATTGGGAGAAGGAGAAAGG - Intergenic
1004511555 6:16287981-16288003 AGTAATAGGATGAAGGAGGAGGG - Intronic
1005943970 6:30582395-30582417 GTTCAGAGGAAGAAGGAGAAGGG + Exonic
1006197619 6:32255423-32255445 TTTAAGAGGCAGGCGGAGGAAGG - Intergenic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006590772 6:35154884-35154906 GTTAAAATGTAAAAGGAGGATGG - Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1009812077 6:68681072-68681094 GGGAATAGGCAGAAAGAAGAGGG + Intronic
1011563938 6:88654589-88654611 GTTACTGGGAAGAGGGAGGAAGG - Intronic
1013089779 6:106889822-106889844 GGTTTTAGGCAGAAAGAGGAAGG - Intergenic
1015308795 6:131741696-131741718 GGAAAAAGGCAGAAAGAGGAAGG + Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1016922918 6:149313942-149313964 GTTAATAGTAAGATGGAAGATGG - Intronic
1016983374 6:149874614-149874636 GTTGATAGTCAGCAGAAGGAAGG - Intergenic
1016991884 6:149935791-149935813 CTTAATAGGAGGAAGGAGCAGGG - Intergenic
1016994426 6:149951680-149951702 CTTAATAGGATGAAGGAGTAGGG - Intergenic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1017834735 6:158167424-158167446 GTTACTAGGGAGAATGAGGCAGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022842847 7:34181171-34181193 GATAATAGGCAGAGGCAGGAAGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023088212 7:36593605-36593627 GTTAATAGGCACAAGGAAGATGG - Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024746339 7:52411031-52411053 GTAAACAGGCACAGGGAGGAGGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026890584 7:73979429-73979451 GTCAAGAGGCAGAAGCAGGCAGG + Intergenic
1027602847 7:80260508-80260530 GTGAATAGGAAGAAGGAGTGTGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030797112 7:113802708-113802730 GTTCACAGGCAGATGCAGGAAGG + Intergenic
1030942545 7:115671607-115671629 TTTAAAAGACAGAAGAAGGACGG - Intergenic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1032622997 7:133556998-133557020 GTTATTAGGCAGATAGAGGGTGG + Intronic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1035274586 7:157740103-157740125 GATAAAAGGCATATGGAGGAAGG - Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1036951258 8:13141731-13141753 TTTAATAGTCAGCAGGAGAATGG + Intronic
1042643099 8:70956542-70956564 GTTCCTGGGCAGAAGGGGGAAGG - Intergenic
1042756988 8:72225563-72225585 GTTAATAGGCATTAGGAATATGG + Intergenic
1042828239 8:72999521-72999543 TTTAATTGGCAGAAGGGGCAAGG - Intergenic
1043334229 8:79152993-79153015 GTTATGAGGCAGAGGGAGAAAGG - Intergenic
1043609498 8:82044982-82045004 GCTAAAAGGGAGAAGGAGGGAGG + Intergenic
1043777019 8:84282498-84282520 GTAAAAAGGCAGGAGGAGGTAGG + Intronic
1043800240 8:84600514-84600536 GTTAATAGGTAAAAGGAGGTTGG + Intronic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1044250844 8:90002136-90002158 GTAAATAGGTAGAAAGAGGTAGG + Intronic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1045827449 8:106415801-106415823 GTTAAAAGGAAAAAGGAAGAAGG - Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1045976431 8:108134669-108134691 GTTAACTGGCAAAAGAAGGATGG - Intergenic
1046526190 8:115384945-115384967 TTTAAAAGGAAGAAGGAGGTGGG + Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1046953610 8:120041487-120041509 GTTAACAGGAAGCAGGAGGCAGG - Intronic
1047085020 8:121506530-121506552 GTCAAGAGGCAGAAAGAGAAAGG - Intergenic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1048507698 8:135035595-135035617 GTTAGAAGACAAAAGGAGGAGGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049993005 9:1007646-1007668 GATACTAGGAAGAAGGAAGAAGG + Intergenic
1050953024 9:11621158-11621180 GGAAATAGGCAGTAGGTGGAAGG - Intergenic
1051044578 9:12857718-12857740 GCTAATAGGGATAAGGAGAAAGG + Intergenic
1051263893 9:15292511-15292533 TTTAATAGGTAGAAGGAGAAGGG - Intronic
1051306174 9:15712320-15712342 GTTACCAGGGACAAGGAGGAAGG - Intronic
1051842247 9:21412264-21412286 GTGAATGGGCAGAAGGATAAAGG - Intronic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052978893 9:34432739-34432761 GTTAAAAGGCAGAACGAGGCTGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055625109 9:78168488-78168510 GTTAATAGAAAAAAGGGGGAGGG - Intergenic
1057640565 9:96816229-96816251 GTTAGAAGGCAGCAGGAGAAAGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1059797683 9:117716543-117716565 GTTCCTAGGGAAAAGGAGGAAGG + Exonic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1186726477 X:12364312-12364334 GTCAAGAGGCGGAAGGAGAAGGG + Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188937421 X:36193754-36193776 GTTAATAGGAGAAAGGAGGGTGG - Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190146130 X:47893169-47893191 GTTAAGAGACTGAAGTAGGAAGG + Intronic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1195172077 X:102279767-102279789 GTTATTAGGCTTAAAGAGGAGGG - Intergenic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1195186783 X:102407326-102407348 GTTATTAGGCTTAAAGAGGAGGG + Intronic
1195672661 X:107482890-107482912 GTTGATGGGCAGAAGGAACAGGG + Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1198970670 X:142275490-142275512 GTTATTAGGCATACAGAGGAAGG - Intergenic
1199333610 X:146591079-146591101 GTTGATAGGAAGAAGAAAGAAGG - Intergenic
1200753517 Y:6968496-6968518 GATAATAGGTAAAAAGAGGAAGG + Intronic
1201741493 Y:17328598-17328620 GGTGATAGGCAGAGGTAGGATGG + Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic