ID: 1086924891

View in Genome Browser
Species Human (GRCh38)
Location 11:92629705-92629727
Sequence CTGAAGAAGGGGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1141
Summary {0: 1, 1: 1, 2: 6, 3: 116, 4: 1017}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086924891 Original CRISPR CTGAAGAAGGGGAAGGAGGT TGG (reversed) Intronic
900141591 1:1141278-1141300 GTGAAGAAGGGGTAGGGGATGGG - Intergenic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
901178025 1:7318869-7318891 ATGAACAAGGGAATGGAGGTGGG + Intronic
901341105 1:8500293-8500315 CTCAAGAATGGGGGGGAGGTTGG - Intronic
901669074 1:10843818-10843840 CAGAAGAAGAGGATGGAGATGGG - Intergenic
902590345 1:17469514-17469536 ATGAAGAAGGGGGTGGGGGTGGG + Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902939936 1:19793719-19793741 CTGGAGGAGGGGCAGGAGGGTGG + Intronic
902960228 1:19958072-19958094 TGGAAGACTGGGAAGGAGGTGGG - Intergenic
902972160 1:20061721-20061743 CTGAAGGAAGGATAGGAGGTGGG - Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903240720 1:21980975-21980997 GTGATGATGGGGAAGGAGGGAGG + Intronic
903244460 1:22005598-22005620 GTGATGATGGGGAAGGAGGGAGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903515270 1:23906223-23906245 TTTAATAAGGGGCAGGAGGTGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904223172 1:28990392-28990414 ATAAAGAGGGGGAAGGAGGGAGG - Intronic
904351143 1:29907463-29907485 CTGAAAAAAGGTAAGGAAGTTGG - Intergenic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904896692 1:33823157-33823179 CTGAGGAAAGGGGAGGCGGTAGG - Intronic
904937028 1:34138411-34138433 CTCAGGGAGGTGAAGGAGGTTGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905272161 1:36794172-36794194 CTGCAGAATGGAGAGGAGGTCGG - Intergenic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905647321 1:39633452-39633474 CTGAAGAAGGGTTAGCAGTTGGG - Intronic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
906533005 1:46534127-46534149 CTGAATAAGGGGGTGGGGGTGGG - Intergenic
906732682 1:48096804-48096826 CGGAAGAAAGGGCAGAAGGTTGG - Intergenic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
906933675 1:50193300-50193322 AGGAAGAAGGGGATGGGGGTAGG + Intronic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
908438525 1:64130653-64130675 CTCCAGAAGAGGAAGGAGGTAGG + Intronic
908642292 1:66238624-66238646 CTGAAAAGGAGAAAGGAGGTTGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909589517 1:77330126-77330148 ATGAAGAGAGGGAATGAGGTTGG + Intronic
909766997 1:79368678-79368700 ATTAAGAATGGGAAGGAGTTTGG - Intergenic
909824156 1:80105051-80105073 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911069730 1:93823137-93823159 CTGAAAGAGGGGAAGGACTTGGG + Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912631006 1:111246784-111246806 GGGAAGGAGTGGAAGGAGGTGGG + Intergenic
912777686 1:112516078-112516100 CTGAAGAAGGGGACAGACATGGG + Intronic
913241008 1:116829331-116829353 CTGAAGAAGAGGAGGTACGTGGG - Intergenic
913345080 1:117800838-117800860 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
913353489 1:117890173-117890195 CTGGTGGTGGGGAAGGAGGTGGG + Intronic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913518151 1:119622623-119622645 CTGACCCAGGGGAAGGAAGTGGG - Exonic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915283473 1:154838293-154838315 CGGGAGTAGGGGAAGGAGCTAGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915358737 1:155273041-155273063 GAGATGAGGGGGAAGGAGGTCGG - Intronic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915721019 1:157985711-157985733 CTGAACAATAGGATGGAGGTTGG + Intergenic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
915976684 1:160395664-160395686 CTGGAGAAGGCGAATGAGTTGGG + Intergenic
916015943 1:160750128-160750150 CTGAAGAAGGTGTAGGACCTGGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917677755 1:177336631-177336653 CTGAATAAGGGAAAGGATTTGGG - Intergenic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918243882 1:182642536-182642558 CTGAAGAAGAAGGAGCAGGTGGG - Intergenic
918344373 1:183593419-183593441 CTGCAGCATGGGAAGGAGTTCGG - Intronic
918373697 1:183887187-183887209 AAGAAGGAGGGGAAGGAGGGAGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920041878 1:203103354-203103376 GGGAAGATGGGGAAGGAGGCAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920202865 1:204270820-204270842 CTGGTGAAGGGGCAGAAGGTGGG - Intronic
920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG + Intergenic
920799589 1:209173998-209174020 CTGAAAAAGGGGCAGGCAGTAGG + Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922072148 1:222205013-222205035 CTGTAGTAGGGAAAGGAGGCTGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923373688 1:233338861-233338883 TTGATGAAGGGGAACCAGGTTGG + Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924362497 1:243255777-243255799 CTGAAGAGTGGGATGGAGGCGGG + Intergenic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063885737 10:10576677-10576699 CTGAAGGAGGTGAAGGGGCTAGG - Intergenic
1063965243 10:11341332-11341354 CTGAACAAGGTGAACTAGGTAGG - Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1066538959 10:36423216-36423238 ATGCAGGAGTGGAAGGAGGTAGG - Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067229236 10:44395344-44395366 TTGAAGAAGGGAAGGGAGTTGGG + Intergenic
1067789059 10:49273810-49273832 GTGAAGATGGGGACGGAGATTGG + Intergenic
1069048227 10:63765110-63765132 GTGAAGATGAGGTAGGAGGTGGG - Intergenic
1069993469 10:72328903-72328925 CTGAGGAGGTGGCAGGAGGTTGG + Intergenic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070888592 10:79925750-79925772 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1071531362 10:86392317-86392339 CTGAAGAAGGGGCAGGGCCTAGG + Intergenic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1071971175 10:90908694-90908716 CTGAAGAGAGGGAAGGAAATGGG - Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1073214075 10:101827045-101827067 CTAGAGTAGGGGTAGGAGGTGGG + Intronic
1073287410 10:102397138-102397160 CTGACCAAGGGGAAAGATGTAGG + Intronic
1073439464 10:103544082-103544104 CTGCAGAGGGGGACGGAGGCTGG + Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073480334 10:103782658-103782680 GGGGAGAAGGGGAGGGAGGTGGG + Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074395370 10:113093399-113093421 CTGAACAAGTGGAAGATGGTTGG - Intronic
1074607289 10:114985848-114985870 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074885440 10:117689327-117689349 GGGAAGAAGGGGAGGGAGGTGGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075686333 10:124367614-124367636 TTGGAGGGGGGGAAGGAGGTGGG - Intergenic
1075686354 10:124367668-124367690 TTGGAGCGGGGGAAGGAGGTGGG - Intergenic
1075913790 10:126148842-126148864 GGGAAGAAGGGGAAAGAGGTCGG - Intronic
1076801897 10:132834859-132834881 TTGCAGAAGGGGCAGGAGCTCGG - Intronic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077318642 11:1930170-1930192 CTGCAGACGAGGAAGGAGGGAGG + Intronic
1077386684 11:2272540-2272562 CTTGACAAGGGGAAGGAGGGAGG - Intergenic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1078391430 11:10938607-10938629 AAGAGGAAGGGGAAGGAGATGGG - Intergenic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079093456 11:17496127-17496149 GGGATGAAGGGGAAGGAGGGGGG + Intronic
1079357410 11:19741421-19741443 CTGAAGTGGGGGAGGGAAGTGGG - Intronic
1079605683 11:22363124-22363146 CTGATGAAGAGGAAAGAGTTAGG + Intronic
1080215752 11:29838127-29838149 CCTAAGAAAGGGTAGGAGGTTGG + Intergenic
1080633784 11:34105740-34105762 GTGGAGAAGGGGAAGCACGTGGG - Exonic
1081085716 11:38797868-38797890 ATGAAGAAGGGGAAGAATTTGGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1081648167 11:44804509-44804531 CTGAAGGAAGGAAAGGAGGGAGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082214359 11:49549766-49549788 CGGAAGAAAGGGAGGGAGGGAGG - Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083338599 11:61944171-61944193 GGGAAGGAAGGGAAGGAGGTAGG - Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1083722043 11:64607974-64607996 GTGAGGAAGGGGTAGAAGGTAGG + Exonic
1083904188 11:65659603-65659625 CTGAATAGGAGGAAGGGGGTTGG - Intronic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084187894 11:67484710-67484732 CTGAACAACGGGAAGGTTGTTGG - Intronic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087822400 11:102727250-102727272 CTGCCGAAGGGGCAGGAGGGAGG - Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089067881 11:115675789-115675811 TTGAAGAAGGGTAGGGAGCTTGG - Intergenic
1089078747 11:115759683-115759705 CTGGAGAAGGGGACGCAGGGAGG - Intergenic
1089183977 11:116602515-116602537 CTGAAAAAGGGGCAGGATGGAGG - Intergenic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1089291903 11:117442757-117442779 CTGAAGAAGAGGTTGGTGGTAGG + Intronic
1089755514 11:120683364-120683386 ATTAAGAAGGGGAAGAAGGGAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090448947 11:126789274-126789296 CTTGAGAAGGCGAAGGAGATGGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090809254 11:130222223-130222245 CAGAAGAAGGGGATGGGAGTAGG - Intergenic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1090946296 11:131432206-131432228 CTTGAGAAGGGGTTGGAGGTAGG + Intronic
1091375277 12:21060-21082 CTCAAGAAGGGTAATGAGGATGG + Intergenic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091828670 12:3534048-3534070 GGGAAGAAGGTGAAGGCGGTGGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092518391 12:9240152-9240174 ATGAAGAAGAGGAAGAAGGTGGG - Intergenic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092796091 12:12111320-12111342 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1092955873 12:13549303-13549325 CTGAAGAAAGGGAAGCATGGGGG - Exonic
1092988971 12:13876448-13876470 CTAAAGCCAGGGAAGGAGGTGGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095347753 12:41171683-41171705 CTGAAGCAGGGGACACAGGTGGG - Intergenic
1095797047 12:46231288-46231310 CCAAAGAAGGGGAAGGTGGGAGG + Intronic
1095904789 12:47366734-47366756 GTGAAGAAGGGGTGGGAAGTGGG - Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096723615 12:53543400-53543422 CTGAAGAACTGTGAGGAGGTGGG - Exonic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097991097 12:65834635-65834657 TTGAAGGAAGGGAAGGAGGGAGG - Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098758003 12:74389549-74389571 CTGAAGCTGGATAAGGAGGTCGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099975620 12:89542838-89542860 TTGAAGAAGAGGAGAGAGGTTGG - Intergenic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100350279 12:93774543-93774565 GTGAAGATGGGTTAGGAGGTGGG + Intronic
1100383002 12:94079168-94079190 CTGATGAAGAGGAATGGGGTGGG + Intergenic
1100591707 12:96035793-96035815 CTGAAGAAGAGGAGGGGAGTAGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1101997367 12:109534666-109534688 TTGAAGCAGGTGGAGGAGGTGGG - Exonic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102441382 12:112966404-112966426 CTGCAGCAGGTGGAGGAGGTGGG - Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102600342 12:114025024-114025046 CTTATGAAGGGGAAAGGGGTGGG - Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102657550 12:114495135-114495157 CAGAAGAAAGTAAAGGAGGTAGG - Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1103013610 12:117476827-117476849 ATGAAGATGGGCAAGAAGGTGGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103480451 12:121247080-121247102 CTGAAGCAGGGCAAGGAAGGTGG - Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103617296 12:122162437-122162459 ATGAAGGAAGGAAAGGAGGTTGG - Intergenic
1104272591 12:127295271-127295293 TTGAAGAAGGGAAAGAAAGTCGG - Intergenic
1105274809 13:18910457-18910479 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1105584332 13:21730168-21730190 CGGCAGAAGAGGAAGGAGATGGG - Intergenic
1105607644 13:21940027-21940049 CTGAAGGATGGGAAGCAGATGGG - Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105977501 13:25485433-25485455 ATAAAGCAGTGGAAGGAGGTTGG - Intronic
1106128807 13:26922491-26922513 CTGGAGAAGGGGAAGGGCCTCGG - Intergenic
1106847539 13:33752292-33752314 CTCAAGCAGGGGAAGGGTGTTGG + Intergenic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107242755 13:38256952-38256974 CTGAAGAATGTGAAGAAAGTAGG + Intergenic
1107332130 13:39312290-39312312 CTGCAGAACAGGAAGGGGGTGGG + Intergenic
1107451335 13:40512778-40512800 CTGAAGAAGGGAAAGGGTGCAGG - Intergenic
1107959125 13:45543254-45543276 CTGTAGTGGGGGAAGAAGGTGGG - Intronic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1109831636 13:67798916-67798938 GGGCAGAAGGGGAAGAAGGTGGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110721641 13:78768646-78768668 CTGAAGAAGGGGAATGGGAGTGG + Intergenic
1110965531 13:81690225-81690247 ATGAAGAAGAGGAAGAAGGTGGG + Intergenic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112044950 13:95587351-95587373 TTGAAGGAGAGGAAGGAGTTGGG - Intronic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1113472848 13:110559077-110559099 CTGAAGAGGGGGAAGAGAGTTGG - Intronic
1113561939 13:111288040-111288062 CTGAAAAAAGGGCAGGAGATAGG - Intronic
1113672587 13:112185067-112185089 CTGATGATGAGGAAGGAGATGGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114890050 14:26908736-26908758 CTGGAGAAGGGGTTTGAGGTAGG + Intergenic
1115658242 14:35464903-35464925 GGGAAGTAGGGCAAGGAGGTGGG + Intergenic
1115693998 14:35876920-35876942 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1115939231 14:38589976-38589998 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939238 14:38590001-38590023 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939245 14:38590026-38590048 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939252 14:38590051-38590073 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939259 14:38590076-38590098 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115939266 14:38590101-38590123 AGGAAGAAAGGGAAGGAGGAAGG + Intergenic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116752882 14:48909102-48909124 CTGAAGGAGGGGAAGAAAGAAGG - Intergenic
1117180436 14:53185777-53185799 CTGAAGAACGGGCAAGAGATTGG + Intergenic
1117872347 14:60214167-60214189 CTGAAGAAGGCTAACGTGGTAGG - Intergenic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119309410 14:73633893-73633915 CTGAAGAGGAGGGAGGAGGGGGG - Intergenic
1119551343 14:75516169-75516191 CCAAAGGAGGGGAAGGAGGGAGG - Intergenic
1119663409 14:76467043-76467065 GTGAAGAAATGGAAGCAGGTGGG - Intronic
1120419083 14:84259711-84259733 CTGCAGAATGGAATGGAGGTTGG + Intergenic
1120801040 14:88688853-88688875 GTGAAGAAGGGAGATGAGGTTGG - Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121171712 14:91859906-91859928 CTAAAGGAGGGGAAAGTGGTAGG + Intronic
1121190684 14:92026711-92026733 ATGAAGAACAGGAAGAAGGTGGG + Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122468371 14:101949457-101949479 CTAAAGATGGGGAGAGAGGTGGG + Intergenic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124216736 15:27813348-27813370 GTGAAGAAGTGGATGGAAGTGGG - Intronic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125444187 15:39736256-39736278 ATGAAGTAGGGGAAAGGGGTGGG - Intronic
1125723012 15:41854102-41854124 CTGATGAAGGGGGAGGACGGAGG - Exonic
1125909400 15:43422537-43422559 GAGAAGACAGGGAAGGAGGTAGG + Intronic
1125929300 15:43589127-43589149 CTGGAGAAGGGGTAGAAGGGAGG + Intronic
1125942467 15:43688959-43688981 CTGGAGAAGGGGTAGAAGGGAGG + Intergenic
1126887127 15:53163146-53163168 CAGAAGAAGGGGAAGAAATTGGG + Intergenic
1127471694 15:59295955-59295977 CTAAAGAGGGGGCAGGAGGAGGG + Intronic
1127572904 15:60261604-60261626 CTGAAGAAGAGGATGGATGTAGG - Intergenic
1127773031 15:62245644-62245666 TTCAAGAAGGGCAGGGAGGTGGG - Intergenic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128801785 15:70501685-70501707 CTGATCAAGGGGAAGGGGTTGGG + Intergenic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129227625 15:74179210-74179232 TTGAAGAAGGGGCAGGATCTGGG - Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129364185 15:75044250-75044272 CTGCAGGAGGGAACGGAGGTTGG + Intronic
1129419513 15:75412825-75412847 CTGAAGGCTGGGAAGGATGTTGG + Exonic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1129708306 15:77807119-77807141 TTGAAGAAGGGGTAGGAGATGGG - Intronic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1129788238 15:78323117-78323139 GGGATGAGGGGGAAGGAGGTGGG + Intergenic
1129816692 15:78561669-78561691 CTGAAGGAGGAGTAGGAGTTAGG + Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129888709 15:79056983-79057005 CTGAAAAAGCGGTGGGAGGTAGG - Intronic
1130327867 15:82896071-82896093 CTGTAGAGGGGGCTGGAGGTGGG + Intronic
1130402307 15:83568633-83568655 CTGAAATACGGGAAGGAGCTCGG + Exonic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131906796 15:97151710-97151732 TTGAAGAGGGGGATGGATGTGGG + Intergenic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1132359594 15:101201482-101201504 CAGAAGGATGGGAAGGAGTTAGG - Intronic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1134897065 16:17897778-17897800 CTAAGGAAGGGGAATCAGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135913138 16:26579190-26579212 AGGAAGAAGGGGAGGGAGGGAGG - Intergenic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137686637 16:50391247-50391269 CTGCAGCAGGGAGAGGAGGTGGG + Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1138568600 16:57852360-57852382 CTGATGATGAGGCAGGAGGTGGG - Intronic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139087274 16:63602547-63602569 GTGAAGATGGGGATGGAGGTGGG + Intergenic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140516947 16:75550133-75550155 GAGAAGAAGGGGAAGCGGGTGGG + Intronic
1141248307 16:82331555-82331577 ATGAAGAAGAGGAAGTGGGTTGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141532415 16:84655774-84655796 CTGAAGAGGGGAAATGTGGTTGG - Intronic
1141581937 16:85005221-85005243 AGGAAGACAGGGAAGGAGGTTGG - Intronic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1142018230 16:87763790-87763812 CTGAAGGAGAGCAAGGTGGTAGG + Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143615290 17:8045936-8045958 CTTAGGAAGGGGAAGGACCTGGG + Intronic
1143749336 17:9016984-9017006 CTGAGGATGGGGGAGGAGCTGGG - Intergenic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144192348 17:12858246-12858268 GTAAAGAAAGGGAAGGAGATGGG - Intronic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1145094281 17:20010460-20010482 TTGAAGATGGGGGAGGAGGGAGG + Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147251969 17:39158094-39158116 TCGAAGAAAGGGAAGGAGGGAGG + Intronic
1147286568 17:39407203-39407225 CTTAAGAAAGGGAGGGGGGTGGG - Exonic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147447060 17:40480867-40480889 CTGGAGATGGGGGTGGAGGTGGG - Intronic
1147637364 17:41972269-41972291 CTGCAGAAGGCGAAGGTGCTTGG - Intronic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148984953 17:51613291-51613313 CGGGAGAAGGGGAAGGAGAGAGG - Intergenic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149514715 17:57271847-57271869 CTGAAGGAGGGGAAAGAGTGAGG + Intronic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1149824180 17:59811977-59811999 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
1149825771 17:59826569-59826591 ATGAAGAAAGGGAAGGATGTGGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1150675525 17:67244199-67244221 CTGGAGCGGGGGAAGGAGGGAGG - Intronic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1151026821 17:70686645-70686667 CTGGAGAGGGGAAAAGAGGTGGG + Intergenic
1151347294 17:73509966-73509988 CCGAAGAAGAGGAAGGGGCTAGG + Intronic
1151447823 17:74178675-74178697 CTTAAGAATGGACAGGAGGTTGG - Intergenic
1151520106 17:74622237-74622259 CTGAGGATGGGGAATGAGATAGG + Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1154261098 18:12833543-12833565 CAGAAGAATGGGAGGGAGTTAGG + Intronic
1154466499 18:14647720-14647742 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1155171852 18:23272595-23272617 GTGAACAAGAGGAAGGAGCTAGG + Intronic
1155555762 18:27017602-27017624 TAGAAGAAGGGTAGGGAGGTAGG + Intronic
1156465140 18:37343964-37343986 CTGAAAAATGGGGAGGAGTTTGG - Intronic
1156495602 18:37523473-37523495 CTGACCAAGGGTAAGGAGTTTGG + Intronic
1157193715 18:45602406-45602428 TTGAAGCAGGGCAAGGAGGCAGG + Intronic
1157431114 18:47627315-47627337 GTGAAGCAGGGGAAGGATATAGG + Intergenic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158618881 18:59013127-59013149 CGGGAGAAGGGGCAGGAGGGTGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160238496 18:77104936-77104958 ATGAAGGAAGGGAAGGAGTTAGG - Intronic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161439399 19:4281994-4282016 CTGAAGTGGGCGAAGGAGGGAGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161713211 19:5861631-5861653 CTGAAGAACGGGAACTAGGCAGG - Intergenic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162766689 19:12924241-12924263 CTGAAGAAGTGGGTGGAGGTCGG - Exonic
1163138994 19:15333346-15333368 CTTAAGGATGGGAAGGAGCTGGG - Intergenic
1163443418 19:17333242-17333264 GTGAAGAAGGCGGAGGAGGTGGG + Intronic
1163567186 19:18058683-18058705 CTGCAGAACGCGAGGGAGGTGGG + Intergenic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164669823 19:30066184-30066206 CTGAAGAAGAGGCATGATGTGGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165150263 19:33756095-33756117 GCGAAGAACGGGAAGGGGGTTGG + Intronic
1165394958 19:35558915-35558937 CTGAAGAGGGATAGGGAGGTAGG - Intronic
1165494249 19:36142412-36142434 CACAAGAAGGGGAGGAAGGTGGG - Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165721053 19:38080032-38080054 GTGGAGCAGGGGAAGGAGTTTGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165847392 19:38827054-38827076 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166704021 19:44898372-44898394 GTGGAGAAGGGAAGGGAGGTTGG - Intronic
1166750894 19:45163527-45163549 CTGAAGGTGGGGGAGGTGGTGGG + Intronic
1166897791 19:46035009-46035031 CTATAGCAGGGGAAGGAAGTTGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168434224 19:56304584-56304606 TGGAAGATGGGGAAGAAGGTGGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925018307 2:548194-548216 CTGAAGACAAGGAAGGATGTTGG - Intergenic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925248835 2:2411454-2411476 GGAAAGAAGGGGAAGGATGTCGG - Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926330088 2:11817250-11817272 ATGAAGGAGGGGAAGGTAGTGGG + Intronic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927461933 2:23306769-23306791 ATGAAGGAGGGGGTGGAGGTGGG + Intergenic
927628627 2:24750911-24750933 CTTAAAAGGGGGAAGGAGGGGGG + Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928336930 2:30406246-30406268 ATGAAGAAGTGGAAGGAATTTGG - Intergenic
928599269 2:32887125-32887147 ATGATGTAGGGGAAGGAGGGAGG + Intergenic
929061436 2:37928708-37928730 CTTGAGAAGGCAAAGGAGGTGGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930366542 2:50446493-50446515 AGGAAGACGGGGAAGGAGGGAGG - Intronic
930418241 2:51117345-51117367 CTGAAGAAAGGGAAGGACATTGG + Intergenic
930492031 2:52086214-52086236 CCCAAGGACGGGAAGGAGGTGGG + Intergenic
931773492 2:65519596-65519618 CTGAAGAAGATGTTGGAGGTGGG - Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932068510 2:68591904-68591926 TGGAAGAAAGGGAAGGAAGTAGG + Intronic
932300866 2:70666131-70666153 GTGTAGAAGGGGGAGGAGATAGG - Intronic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933314845 2:80703695-80703717 CTGGAAGAGAGGAAGGAGGTTGG + Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934916924 2:98307908-98307930 CAGAAGGAAGGAAAGGAGGTTGG - Intronic
935148083 2:100409928-100409950 AAAAAGCAGGGGAAGGAGGTGGG - Intronic
935469694 2:103443492-103443514 CTGAAGGATAGGAAGGAGGGTGG + Intergenic
935523809 2:104141984-104142006 CTGTAGAAGGGTCAGAAGGTGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936393782 2:112102119-112102141 CTTTAGAAGGTAAAGGAGGTGGG + Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936466713 2:112758655-112758677 CTGAAGAGGTGGAGGGACGTTGG + Intronic
936715362 2:115180920-115180942 CTTAAGAAAGGGAGGGAGGCAGG - Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937419258 2:121740847-121740869 AGGAAGAAAGGGAAGGAGGAAGG - Intronic
938117028 2:128609054-128609076 CTGAAGAAGGGGTTGGATCTGGG + Intergenic
938120347 2:128628601-128628623 CCGAAGAAAGGGAGGGAGGAAGG - Intergenic
938375892 2:130806418-130806440 CTTAATAAGGGGTAGGATGTGGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
938562952 2:132490714-132490736 CTGAACAGGGTGAGGGAGGTAGG + Intronic
938757897 2:134397491-134397513 CTGGAGGAGAGAAAGGAGGTGGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939337478 2:140849058-140849080 CTTAAGTAGGGGAGGGAGGCCGG + Intronic
940006869 2:149016324-149016346 CTGAAGAAGGGGTAGGAATGGGG + Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941234021 2:162946623-162946645 GGGAAGAAGGGGAAGGAGAAGGG + Intergenic
941408650 2:165124936-165124958 CTGAAGCAGGGGAAGGCAATTGG - Intronic
941696199 2:168553847-168553869 GAGTAGAAGGGGAAGAAGGTGGG + Intronic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
941819826 2:169833052-169833074 CTGAAGAGTGGGTGGGAGGTGGG - Intronic
941923735 2:170875706-170875728 CTGAGGAGGGTAAAGGAGGTTGG - Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942452193 2:176115258-176115280 GTAAGGGAGGGGAAGGAGGTGGG - Intronic
942547983 2:177084335-177084357 CTGCAGAGAGGGAAGGAGCTGGG + Intergenic
942650660 2:178163922-178163944 GTGAAGAAGGGGGAGGAGTTGGG - Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943793682 2:191965238-191965260 AAGAAGCAGGGGAAGGAAGTGGG - Intronic
943808907 2:192159731-192159753 CTGAAGCAGGGCAATGAGGTGGG - Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944069184 2:195650948-195650970 GTGGGGAAGGCGAAGGAGGTGGG + Intronic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
945014028 2:205495732-205495754 ATGAAGGAAGGGAAGTAGGTTGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945758176 2:213876667-213876689 CTTGAGAAGGGGAAGGATGGAGG - Intronic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947198723 2:227595895-227595917 CTGAAGAAAGGGGAGAAGATAGG + Intergenic
947379991 2:229536193-229536215 CTGAGGAAGGCTGAGGAGGTTGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947641963 2:231711930-231711952 ACGAAGAAGAGGAAGAAGGTGGG + Exonic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948091699 2:235301334-235301356 CTAAAGAAGGGAAGGGAGCTTGG - Intergenic
948282710 2:236760250-236760272 AGGAAGAAAGGGAAGGAGGGAGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948612970 2:239181240-239181262 CTGCAGAGGTGGCAGGAGGTAGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948883191 2:240870691-240870713 CTGCAGGAGGTGGAGGAGGTAGG + Exonic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168973362 20:1946021-1946043 GGGAAGAAGGGAGAGGAGGTAGG + Intergenic
1169121769 20:3100937-3100959 CTGAAGCGGGAGGAGGAGGTTGG - Intergenic
1169691857 20:8341072-8341094 TGGAACAAGGGAAAGGAGGTTGG - Intronic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170623368 20:18012110-18012132 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
1171148978 20:22810315-22810337 TTCAAGAAGGGGCAGGAGGGCGG + Intergenic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1172035876 20:32010467-32010489 GTCAAGAAAGGGAAGAAGGTAGG + Exonic
1172254765 20:33507939-33507961 GTGAAGAATGGGTAGGAGATGGG + Intronic
1172416709 20:34775035-34775057 ATGAACTAGGGGAAGGGGGTTGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172555226 20:35834978-35835000 CTCAAGAAGAGGTAGGAGGCCGG + Intronic
1172692930 20:36803079-36803101 CTGAAGACAGGGAAGGGGGCCGG - Exonic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173270440 20:41529586-41529608 CTGAAGAATGGAAAGGACTTGGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1173995342 20:47333931-47333953 ATTAAGAAAGGGAAGGAGGGAGG + Intronic
1174117593 20:48237925-48237947 CTGCAGCAGGGGAGTGAGGTGGG - Intergenic
1174163919 20:48571222-48571244 CTGCAGCAGGGGAGTGAGGTGGG + Intergenic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174465102 20:50711216-50711238 CTGAAGGAGGGAAAGGGTGTGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174654149 20:52156218-52156240 CTAAAGGAGGGGTGGGAGGTGGG - Intronic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176158670 20:63637176-63637198 CTGAAGGCTGGGCAGGAGGTGGG - Intergenic
1176808095 21:13510881-13510903 AGGAAGAAAGGGAAGGAGGGAGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178081754 21:29073501-29073523 CTGAAGGAAAGGAATGAGGTGGG - Intronic
1178100537 21:29264054-29264076 CTGAAGAGAGGGAGAGAGGTGGG + Intronic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1179021317 21:37643508-37643530 CTGAAGAATGGGCAAGGGGTGGG + Intronic
1179288042 21:39994988-39995010 CTGAAGACTGGGTAGGAGTTAGG + Intergenic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182008312 22:26979673-26979695 AGGAAGAAAGGGAAGGAGGGAGG - Intergenic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183598116 22:38824397-38824419 CTGCAGGAGGGGAAGGACTTTGG + Intronic
1183778462 22:39983428-39983450 CAGAAGCAAGGGAAGAAGGTGGG - Intergenic
1184101248 22:42342781-42342803 CTGAAGGAGGGGGAGGAAATGGG - Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184411116 22:44327080-44327102 CTGAATATGGGGAAGCAGATCGG + Intergenic
1184869071 22:47222121-47222143 GTGGAGGAGGGGAAGGAGCTAGG - Intergenic
1185040763 22:48502997-48503019 CTGCAGAGGTGGAAGGATGTGGG + Intronic
1185305495 22:50113124-50113146 TAGAAGAAGGGGAAGTAAGTGGG + Intronic
949165454 3:935184-935206 TGGAAGAAGGGAAAGCAGGTGGG + Intergenic
949494522 3:4619524-4619546 CGGCAGAAGGGGATGGAAGTTGG - Intronic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
949677042 3:6467377-6467399 ATGAAGGAGGGGAGGGAGGGAGG + Intergenic
949851120 3:8421441-8421463 CTGCAGTAGGGGTAGGAGGTGGG + Intergenic
949965698 3:9354308-9354330 CTGCAGGAGAGGAAGAAGGTGGG + Intronic
950040406 3:9916156-9916178 CTGAAGGAGGGTGAGGCGGTGGG + Exonic
950174167 3:10860730-10860752 TTGAAGAGGGGGAAGCAGGGAGG + Intronic
950298269 3:11850833-11850855 CTGATGGAGGGGAAGGAGAGGGG + Intergenic
950430436 3:12947820-12947842 CTGGAGAAGGGGGAAGAGCTTGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950527096 3:13530656-13530678 TTTAAGAAGGGGAGGGATGTGGG - Intergenic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
950662826 3:14477325-14477347 CTGACGATGGTGACGGAGGTAGG + Exonic
952649400 3:35707214-35707236 GGGAAGGAGGAGAAGGAGGTTGG - Intronic
952885659 3:38009771-38009793 CTGCTGAAGGGGAAGAAGCTCGG - Exonic
953083430 3:39643266-39643288 CTGAAGAAGGGGAGCCAAGTGGG + Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953826145 3:46252600-46252622 ATGAAGGAAGGGAAGGAAGTGGG + Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955153898 3:56396797-56396819 CTGAAGCATGGGGAGGAGGGTGG + Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
956068116 3:65418549-65418571 TTTAAGAAGGGGAAGAAGATGGG - Intronic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956491328 3:69775079-69775101 CAGATGAGGGGCAAGGAGGTGGG - Intronic
956724457 3:72145750-72145772 CTGGAGAGTGGGAAGGGGGTAGG - Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958188035 3:90148252-90148274 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958410555 3:93810077-93810099 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960243300 3:115371180-115371202 AAGAAGAAAAGGAAGGAGGTAGG - Intergenic
960386453 3:117026855-117026877 ATGAAAAAGTGGAAGAAGGTGGG + Intronic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961263183 3:125618933-125618955 ATGAAGCAGGTGAAGAAGGTGGG + Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961542145 3:127607255-127607277 CTGAATATGGTGCAGGAGGTTGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
961870200 3:129982001-129982023 CTGAAGAGTTGGAAGGAAGTAGG - Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962929345 3:140022675-140022697 GTGGAGAATGGGATGGAGGTGGG + Intronic
963082270 3:141404907-141404929 GAGAAGCAGGGGAAGAAGGTGGG - Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963492451 3:146018349-146018371 CTGGAGAAGGGAAAGCAGCTTGG - Intergenic
964104450 3:153023983-153024005 GTGATGCAGGGGAAGGATGTTGG - Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
965478246 3:169184590-169184612 CTGAGGAAGAGGTAGGAGCTAGG + Intronic
966107975 3:176360662-176360684 TCGAAGCAGGGGAAGGAGATTGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966991650 3:185237900-185237922 CTTCAAAAGGGCAAGGAGGTTGG - Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967328295 3:188264566-188264588 ATGAGGTAGGGGAGGGAGGTGGG + Intronic
967370877 3:188744700-188744722 CTGAAGAGGGGAAAGGAGGTTGG - Intronic
967845286 3:194038065-194038087 TTGAAGAAAGGGAAGGACTTCGG - Intergenic
968047454 3:195632054-195632076 CTGACCCAGGGGCAGGAGGTGGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968177832 3:196566785-196566807 CTGAACATGGGGAAGGGGCTTGG + Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968307159 3:197657870-197657892 CTGACCCAGGGGCAGGAGGTGGG - Intergenic
968339253 3:197941299-197941321 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
968633548 4:1665820-1665842 ATGAAGAATGGGAGGGAGGGAGG + Intronic
968939830 4:3631993-3632015 CTGAAGAAAGGCAAGGGGGCTGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969457455 4:7308293-7308315 CAGCAGAAGGGGCAGGGGGTTGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969495209 4:7522699-7522721 CGGGAGAAGGGGAAGGATGGGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969864633 4:10066546-10066568 AAGAAGAAAGGGAGGGAGGTAGG + Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
971175498 4:24278654-24278676 GAGAAGAAAGGGAAGGAGTTGGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
971717159 4:30193560-30193582 AGGAAGAAAGGGAGGGAGGTAGG - Intergenic
972239750 4:37177631-37177653 CTGAAGACTGGGTAAGAGGTGGG + Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
973314361 4:48744333-48744355 TTGAAGGAGGGGAAGGAGAGAGG + Intronic
973739997 4:53910444-53910466 CTGAACAAAGGCAAAGAGGTAGG + Intronic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
974673527 4:65061775-65061797 CTGAAGAGGGGGAATGACTTCGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977805155 4:101288592-101288614 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
977865767 4:102025742-102025764 AGGAAGAAAGGGAAGGAGGGAGG - Intronic
978437481 4:108701299-108701321 GAGAAGAAGGGAGAGGAGGTAGG - Intergenic
978697549 4:111600453-111600475 CCAAAGAAAGGGAGGGAGGTTGG - Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
979512959 4:121574824-121574846 AGGAAGCAGGGGATGGAGGTGGG + Intergenic
979618960 4:122776448-122776470 CTGAGGAACTGGGAGGAGGTGGG + Intergenic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981010388 4:139919236-139919258 TTGAAGAAGGGGGAGGAAGGGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981333311 4:143538081-143538103 CTAAAGAAGTGGAAGGCAGTCGG + Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981936695 4:150247060-150247082 AAGAAGAAGGGAAAGGAGATCGG + Intronic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983525146 4:168753333-168753355 AGGAAGCAGGGGAAGGAGGGAGG - Intronic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
984028352 4:174572126-174572148 CTGAAAAAGGGGAATAATGTTGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984963439 4:185120363-185120385 CTAAAGAATGTAAAGGAGGTTGG - Intergenic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985647895 5:1093707-1093729 CTGAACACGGGGAGGGAGGTCGG - Intronic
985701384 5:1375200-1375222 CTGAAGAGAGGGGATGAGGTAGG + Intergenic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985808607 5:2067038-2067060 CTGCAGAAGGTGAGTGAGGTCGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986128025 5:4901718-4901740 CTGATGGAGTGGAAGGATGTGGG - Intergenic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
986522367 5:8633365-8633387 AGGAAGAAGGGGAAGGAAGTGGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987095434 5:14545518-14545540 CGCAAGAAGGGGAAGGAGGGAGG - Intergenic
987247058 5:16059806-16059828 CTGAAGAGGGCGGAGGGGGTGGG - Intergenic
987724362 5:21678879-21678901 CTGAAGAGGGGTAAGAAGTTGGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988898651 5:35707318-35707340 TTGATGATGGGGAAGGAGATAGG + Intronic
988999239 5:36743975-36743997 CTGAAGAATAGCAGGGAGGTTGG - Intergenic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
991100665 5:62789055-62789077 ATGAAGAAGTCAAAGGAGGTAGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992953384 5:81883157-81883179 CCCAAGGAGGGTAAGGAGGTCGG + Intergenic
993318157 5:86437454-86437476 CTGAAGGAATGGCAGGAGGTGGG + Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993607705 5:90014387-90014409 AGGAAGGAAGGGAAGGAGGTGGG + Intergenic
994431295 5:99664856-99664878 CTGAAGAAAGGGAGAGAGATGGG + Intergenic
995439039 5:112169709-112169731 CTAAAGATGGGGACGGAGGGTGG + Intronic
996055113 5:118973953-118973975 ATGAAGAAGAGGAAGAAGGTGGG + Intronic
996129570 5:119765414-119765436 AGGAAGTATGGGAAGGAGGTTGG - Intergenic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996524205 5:124460621-124460643 CTGAAGAACAGGAATGGGGTGGG - Intergenic
996687306 5:126297059-126297081 GGGAAGATGGGGAAGGGGGTTGG - Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
997361045 5:133295116-133295138 CTGAGGAGGGAGAAGAAGGTCGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997618072 5:135266293-135266315 CTGGAGATGGGGAGGGAGCTGGG + Intronic
997635491 5:135400974-135400996 CTGTAGAGGGGCATGGAGGTGGG - Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
997990358 5:138540019-138540041 CTGAATAAAGGGAAGTATGTTGG - Intronic
998170436 5:139869517-139869539 CTGGAGAAGGGCAGGGGGGTGGG - Intronic
999047500 5:148485004-148485026 AGGAAGAAAGGGAAGGAGGAAGG + Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000362702 5:160462722-160462744 TTGTAGAGGGGGAAGCAGGTTGG + Intergenic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001966520 5:175913684-175913706 AGCAAGTAGGGGAAGGAGGTGGG + Intergenic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002454955 5:179340662-179340684 CTGTAGAAGGGGGATGATGTCGG + Intronic
1002539163 5:179894517-179894539 CTGAAGATGCGGAAGCAGTTTGG - Exonic
1002606420 5:180385425-180385447 TGGGAGAAGGGGAAGGACGTGGG + Intergenic
1002703559 5:181144571-181144593 CTGCAGAAGGCAAAGGGGGTAGG - Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003488728 6:6602067-6602089 GTCAAGAAGGGGAAGGAAGGTGG - Intronic
1003491747 6:6628285-6628307 AGGAAGAAGGGGAGGGAGGGAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004314709 6:14575651-14575673 CTGAAGAATGGCAAGGAATTGGG + Intergenic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1004811554 6:19269306-19269328 AGGAATAAGGGGAAGGATGTGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005885912 6:30097584-30097606 GTGAAAAATGGGAAGCAGGTGGG + Intergenic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397471 6:41585943-41585965 AAGAAGAAGGGGAAGAAGCTGGG - Intronic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008035766 6:46743528-46743550 CTTTAGAATTGGAAGGAGGTAGG + Intergenic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013034725 6:106370290-106370312 CAGAAGAAGGGGTACGAAGTAGG - Intergenic
1013817514 6:114116672-114116694 AAGAGGATGGGGAAGGAGGTGGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016318723 6:142818982-142819004 CAGAAGAAAGGAAAGGAGGGAGG + Intronic
1016801476 6:148173513-148173535 AAGAAGAAGGGGAAGAAGGGGGG + Intergenic
1016843038 6:148543802-148543824 CTGAAGCAGGGACAGGAGGAGGG + Exonic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017355180 6:153496733-153496755 CTGAAAAAAGGGAGGAAGGTGGG - Intergenic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1018248160 6:161841941-161841963 TTGCAGCAGGGGAAGGAGATTGG - Intronic
1018287454 6:162256134-162256156 ATGAAGAAGGTGTAGGAGTTTGG + Intronic
1018373647 6:163191279-163191301 CTGAAGCCTGGGAAGGAAGTAGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019898517 7:4001332-4001354 CCAGAGAAGGGGCAGGAGGTTGG - Intronic
1020592818 7:10164664-10164686 CTGAAGAATCTGAAGTAGGTGGG - Intergenic
1020779159 7:12496439-12496461 GAGAAGAAGGGAAAGGAGTTTGG - Intergenic
1021231068 7:18086781-18086803 GGGAAGTAGGGGACGGAGGTGGG - Intergenic
1021308633 7:19063484-19063506 TTGAGGAGGTGGAAGGAGGTGGG - Intronic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021610591 7:22454237-22454259 CTGAGGCAGGGGTTGGAGGTGGG - Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021971103 7:25966772-25966794 AAGAAGAAAGGGATGGAGGTAGG + Intergenic
1022240524 7:28507642-28507664 CTGAAGAACTGCGAGGAGGTGGG + Exonic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1023137229 7:37064738-37064760 CTGCAGATGGGGAAGGAGATAGG - Intronic
1023318199 7:38963623-38963645 GTGAAGCAGGTGAAGGATGTAGG + Intergenic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1023854645 7:44175222-44175244 AAGAAGAAGGGGAAGCAGTTAGG - Intronic
1023862365 7:44224349-44224371 CTGATGGAGGGAAAGGAGGGGGG + Intronic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024471092 7:49769470-49769492 TTGAAGAAAGGGAAGAAGGAAGG - Intergenic
1024516390 7:50262602-50262624 AAGAAGAAGGGGAGGGAGATGGG - Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1025790007 7:64680373-64680395 CTGAAGAATGGGAGGGTGTTTGG + Intronic
1026986960 7:74560875-74560897 CTTAAAAAGGGTCAGGAGGTCGG - Intronic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027630881 7:80604128-80604150 CTAGAGGAGGGGAATGAGGTTGG + Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028746859 7:94337129-94337151 ACGAAGTAGGGTAAGGAGGTAGG - Intergenic
1029284693 7:99457622-99457644 CTGATGAAGAGGAAGCAGGGAGG + Intronic
1029676647 7:102074433-102074455 TTCAGGAAGGGGAAGCAGGTGGG - Intronic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1029980953 7:104878551-104878573 CTGAAGAGAGGGAAAGAGATGGG - Intronic
1030797681 7:113809061-113809083 ATGCAGAAAGGCAAGGAGGTGGG + Intergenic
1031150666 7:118050350-118050372 CAGAAGCAGGGAAAGGAGATTGG - Intergenic
1031446123 7:121857020-121857042 TTGAAGAATGGGAGGGAGGGAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031912979 7:127536887-127536909 CTGAAGGTGGGGGAGAAGGTTGG + Intergenic
1032226103 7:130032839-130032861 GGGAAGGAGGGGAAGGAGGGAGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032654014 7:133907853-133907875 AAGAAGGAGGGGAAGGAGGGAGG + Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1032978190 7:137249981-137250003 CTGCAGAAGGTGATGGAGATTGG - Intronic
1033093029 7:138404345-138404367 ATGAACAAGAGGAAGAAGGTGGG - Intergenic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034244608 7:149634940-149634962 CTGAAGAAGGAGGAGGAATTAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034354015 7:150436476-150436498 CTAAAGATGTTGAAGGAGGTGGG + Intergenic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035047215 7:155975557-155975579 CTGAGGAGGGGTGAGGAGGTGGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035665418 8:1376574-1376596 CTGAAGAAGGGGGAGCCGGGTGG + Intergenic
1036020465 8:4839154-4839176 CTGATGAAGGGAAAGAAGGATGG - Intronic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037782709 8:21881697-21881719 CAGCAGTAGGGGAAGGGGGTGGG - Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038208394 8:25491371-25491393 ATGAAGAAGGGCCAGGGGGTAGG + Intronic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038540994 8:28389956-28389978 ATGAAGCAGGGAAGGGAGGTGGG - Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039331311 8:36540080-36540102 CTACAGAATGGGAAGGGGGTGGG + Intergenic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1040840192 8:51776796-51776818 TTGCAGGAGGGGAAAGAGGTGGG - Intronic
1041219512 8:55634621-55634643 TTGAAGAAGTGGTAGGTGGTTGG + Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041629546 8:60070913-60070935 CTGAGGTAGTGGAAGCAGGTAGG - Intergenic
1041641381 8:60206657-60206679 ATGATGAAGGGGCAGGAGCTAGG - Intronic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1042454401 8:68983814-68983836 TGGAAGAAGGGGAATGAAGTCGG + Intergenic
1044402237 8:91786161-91786183 GGGAAGAAGGGGAAGGAGAAGGG - Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044902768 8:96966367-96966389 ATGAATAAGGGAAAGGAAGTAGG - Intronic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046204792 8:110979082-110979104 CTAAAGAAGAGCAAGGAGATTGG - Intergenic
1046485920 8:114888393-114888415 AGGAAGAAAGGGAAGGAGGAAGG - Intergenic
1046555585 8:115768787-115768809 GGGAAGAAGGGAAGGGAGGTAGG - Intronic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1046836079 8:118803077-118803099 CTGTAGGAGGGGAAGCAGATGGG + Intergenic
1046854800 8:119019029-119019051 CTGCAGAAGGGGAAGATAGTAGG - Intronic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1047021210 8:120776694-120776716 CTTATGAGGGGGAAGCAGGTGGG - Intronic
1047218728 8:122901272-122901294 CAGAAGCAGGGGAGGTAGGTTGG - Intronic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048516062 8:135112798-135112820 CTGAAGATGTGGAAGCAGCTTGG + Intergenic
1048828816 8:138456394-138456416 CTGAAGAGGGTGAAGGGAGTGGG + Intronic
1049285847 8:141774838-141774860 CTGGAGAGGAGGACGGAGGTTGG - Intergenic
1049436252 8:142587497-142587519 CTGCAGAACGGGAGGGAGTTGGG + Intergenic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049811933 8:144579547-144579569 CTGCAGAGTGGGCAGGAGGTGGG - Intronic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050277796 9:4018152-4018174 AGGAAGAAAGGAAAGGAGGTAGG + Intronic
1050350797 9:4739979-4740001 CCGAAGAATGGGACTGAGGTAGG + Intronic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051606612 9:18923300-18923322 CTGGAGCAGAGGATGGAGGTGGG + Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1052066241 9:24024122-24024144 CTGTAGAAGGGGAAAAACGTAGG - Intergenic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054450930 9:65403317-65403339 CTGAAGAAAGGCAAGGGGGCTGG + Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055130750 9:72771428-72771450 CTGAAGAAGGGAAGTGAAGTGGG - Intronic
1055420584 9:76136977-76136999 CTGAAGAAATGTAAGGAGGTTGG - Intronic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055771047 9:79717424-79717446 TTGCTGGAGGGGAAGGAGGTGGG - Intronic
1056447408 9:86679115-86679137 CTGAAGAAGGGCAGAGGGGTAGG - Intergenic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057357979 9:94347384-94347406 ATGAAGAAGGGGAAGAAAGTGGG - Intergenic
1057430352 9:94988286-94988308 CTCACGACGGGGAAGGACGTTGG + Intronic
1057506714 9:95640070-95640092 CTCAAGAATGGGAAGGAGTCAGG + Intergenic
1057649771 9:96910233-96910255 ATGAAGAAGGGGAAGAAAGTGGG + Intronic
1057773260 9:97984786-97984808 TTTAAGAAGGGGGAGGGGGTCGG - Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1058268952 9:102944981-102945003 CTTAAGAAAAGGAAGGAGGTGGG - Intergenic
1058469994 9:105268007-105268029 CTCAAGCAGGGAAAGAAGGTTGG + Intronic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059473771 9:114527467-114527489 CTGAAGTAGTGGGAGCAGGTGGG + Intergenic
1059489982 9:114658968-114658990 CTGGAAAAGAGAAAGGAGGTTGG - Intergenic
1059585521 9:115601931-115601953 AGGAAGATGGGGAAGGAGATAGG + Intergenic
1059754351 9:117278520-117278542 ATGAAGAGGGGGAAGGGGTTAGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1060473241 9:123965980-123966002 CAGAAGAAGGGGAAAGATCTGGG - Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1060847127 9:126846457-126846479 ATGAAGAAAGGTACGGAGGTGGG + Intergenic
1061001118 9:127903631-127903653 CTCAGGAAGCGGATGGAGGTGGG - Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061360780 9:130141014-130141036 GGGAAAAAGGGGAAGGATGTGGG - Intergenic
1061670348 9:132184993-132185015 CTTAAGAAGGGGAAGGCGCTGGG + Intronic
1061706516 9:132457290-132457312 CTTAAGACGGGGACGGGGGTGGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061746636 9:132745056-132745078 TGGAAGAAGGGGAAATAGGTGGG - Intronic
1061766027 9:132882034-132882056 CTGAAGGTGGGGAATGAGATGGG - Intronic
1061883477 9:133579281-133579303 CTGAAGGAGGTGGAGGCGGTGGG + Exonic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1187203342 X:17157354-17157376 CTGAAGGAAGGTGAGGAGGTGGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1188232270 X:27679375-27679397 TTGAAGAAGGGGAAGTAATTTGG + Intronic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195693982 X:107653196-107653218 CTAAAGCAGGGGTAGGAGGCTGG + Intergenic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199907232 X:152245585-152245607 CTGGAGAATGGAAATGAGGTTGG - Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201305305 Y:12544911-12544933 CTGAAGAAGTGTCTGGAGGTGGG + Intergenic
1202143234 Y:21751070-21751092 CTAAAGTAGGGGAAGCAGGAGGG - Intergenic