ID: 1086928130

View in Genome Browser
Species Human (GRCh38)
Location 11:92663006-92663028
Sequence TAGGAAGACTGTGATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 356}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086928121_1086928130 18 Left 1086928121 11:92662965-92662987 CCGGTTCCTCACAGACTCCAGTT 0: 1
1: 0
2: 3
3: 16
4: 254
Right 1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 356
1086928122_1086928130 12 Left 1086928122 11:92662971-92662993 CCTCACAGACTCCAGTTCATTGC 0: 1
1: 0
2: 2
3: 42
4: 320
Right 1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 356
1086928120_1086928130 19 Left 1086928120 11:92662964-92662986 CCCGGTTCCTCACAGACTCCAGT 0: 1
1: 0
2: 2
3: 23
4: 275
Right 1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 356
1086928125_1086928130 1 Left 1086928125 11:92662982-92663004 CCAGTTCATTGCTGGAGACTGGC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086928130 Original CRISPR TAGGAAGACTGTGATGGGGT AGG Intronic
900122780 1:1055987-1056009 TAGGAGGACTGGGCTGGGGCTGG - Exonic
900575228 1:3379515-3379537 TGGGAGGACTGTGTTGGGATGGG - Intronic
900575281 1:3379683-3379705 TGGGAGGACTGTGTTGGGATGGG - Intronic
900575293 1:3379725-3379747 TGGGAGGACTGTGTTGGGATGGG - Intronic
900703064 1:4059938-4059960 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
900908886 1:5580153-5580175 TAGGAAGCCTTTGGTGGGGTGGG - Intergenic
901064989 1:6490239-6490261 TAGAGACACTGTGATGGGGGCGG + Intronic
901220172 1:7579194-7579216 TAGGAGGACTGTGAGGGTGGAGG - Intronic
901505664 1:9683811-9683833 TGGGAAGACTCTCAAGGGGTTGG + Intronic
902187765 1:14738211-14738233 TCCCAAGACTGTGATGGGATGGG + Intronic
902530469 1:17087456-17087478 TAAAAAGACTGTGATGGAGATGG - Intronic
903605465 1:24572354-24572376 AAGGAAGGGTCTGATGGGGTTGG - Intronic
904411845 1:30329436-30329458 GAGGAAGTCGGGGATGGGGTAGG - Intergenic
904756104 1:32769800-32769822 TAGGAGGGCAGTGGTGGGGTGGG + Intronic
905282231 1:36856551-36856573 ACGGAGGACTGTGCTGGGGTCGG + Intronic
905424704 1:37874000-37874022 GAGGAAGCCTCTGCTGGGGTTGG + Exonic
906621029 1:47279407-47279429 GAGGAACACTGTTTTGGGGTAGG + Intronic
907274918 1:53311622-53311644 TAGGGAGAGAGAGATGGGGTGGG - Intronic
908049325 1:60210601-60210623 TCTGGCGACTGTGATGGGGTCGG + Intergenic
908240974 1:62188760-62188782 TAGGGTGACTGGGATGGAGTTGG + Intergenic
909280258 1:73742315-73742337 GAGGAAGACAGTGAAGGGGGAGG - Intergenic
910051706 1:82981999-82982021 CAGGAAGATGGGGATGGGGTCGG + Intergenic
910104908 1:83621583-83621605 TAGGAAGGGTGTGTTGGGGGTGG + Intergenic
912185152 1:107266425-107266447 GAGGAAGACAGTGAAGGGGAAGG + Intronic
912786478 1:112608787-112608809 TAGGAATAGTGGGGTGGGGTTGG - Intronic
913161402 1:116149088-116149110 TATCAAGACTGAGGTGGGGTGGG - Intergenic
914764899 1:150629361-150629383 TGGGGAGACCGTGATGGGGCGGG - Intronic
914794262 1:150906726-150906748 TGGCCAGACTGTGATGGGTTGGG - Intergenic
915552543 1:156643696-156643718 TATGAAGACTGTGAGGGAGATGG + Intronic
915840528 1:159209150-159209172 GAGGAAGGTGGTGATGGGGTTGG - Intergenic
916432527 1:164744865-164744887 TAAGAAGACAGTGGTGGGGGTGG + Intronic
917095086 1:171392029-171392051 AGGGAATAGTGTGATGGGGTGGG - Intergenic
917392781 1:174557453-174557475 TAGAATGACGGGGATGGGGTAGG - Intronic
917616606 1:176752178-176752200 TCGGGGGACTGTGGTGGGGTCGG + Intronic
918354188 1:183690432-183690454 AAGGAAGAATTCGATGGGGTAGG + Intronic
918945887 1:191064371-191064393 TCTGGGGACTGTGATGGGGTGGG + Intergenic
919468609 1:197951636-197951658 CAGGATGACTGGGGTGGGGTTGG - Intergenic
920229623 1:204461767-204461789 AAGGAAGAGTGTGGTGGGGCTGG + Intronic
920704167 1:208239830-208239852 TGGGAAGAGTATGCTGGGGTAGG + Intronic
921067517 1:211633130-211633152 GAGGAAGACAGTGAGGGGGCAGG + Intergenic
922584628 1:226724280-226724302 TAGGAAGTGTGTGCTGGGGGAGG - Intronic
923040810 1:230318731-230318753 TGGGGAGAGTGGGATGGGGTGGG - Intergenic
923518110 1:234714277-234714299 TAGGAAAGGTGTGATGGGGTAGG + Intergenic
923595102 1:235355147-235355169 TAGGAAGACAGGGAAAGGGTAGG + Intergenic
1063968294 10:11363596-11363618 TGGGAAGCATGTGATGGGGCAGG + Intergenic
1065428961 10:25634085-25634107 TGAGAAAACTGTGATGGGGCGGG - Intergenic
1065609614 10:27459229-27459251 TGGGAAGGTTGGGATGGGGTAGG + Intergenic
1065689546 10:28319171-28319193 GAGGAAGAGGGTGAAGGGGTAGG + Intronic
1068015559 10:51512349-51512371 TCTGGAGACTGTGGTGGGGTGGG - Intronic
1068573152 10:58653836-58653858 TCTGAGGACTGTGGTGGGGTGGG - Intronic
1068930392 10:62583288-62583310 TAAGAAGACAGTGATGAGATAGG + Intronic
1069125831 10:64631711-64631733 TATGAAGATTGTCATGGAGTGGG - Intergenic
1069594047 10:69659111-69659133 TGGGGAGATTGTGGTGGGGTGGG + Intergenic
1070641947 10:78176720-78176742 GAGGAAGACTGTGATGGGGAGGG + Intergenic
1075171712 10:120121602-120121624 TATAAAGACTGTGATAGGCTGGG + Intergenic
1075448037 10:122527333-122527355 CAGGAAGAATGGGATTGGGTGGG - Intergenic
1075517361 10:123119462-123119484 CAGGAAGACTGGGAAGGGGCAGG - Intergenic
1077795100 11:5483343-5483365 TCTGGGGACTGTGATGGGGTGGG + Intronic
1078790642 11:14538649-14538671 GAGGAAGCCTGTGAAGGGGTTGG - Intronic
1079377692 11:19908307-19908329 AAGTAACACTGTGGTGGGGTGGG + Intronic
1080446850 11:32345553-32345575 CAGGAAGAGAGTGATGGGATTGG - Intergenic
1081771400 11:45652334-45652356 TTAGAAGAATGTGGTGGGGTGGG - Intronic
1082228035 11:49731142-49731164 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1083508617 11:63185698-63185720 TATGGGGACTGTGGTGGGGTGGG - Intronic
1084073435 11:66753331-66753353 ATGGAAGACTTTTATGGGGTAGG + Intronic
1084706219 11:70817361-70817383 CAGGGAGGCTGTGAAGGGGTGGG + Intronic
1085472282 11:76766192-76766214 CAGGCAGACAGTGATGGGGTGGG - Intergenic
1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG + Intronic
1087051195 11:93888005-93888027 TAGAAAAACTGTACTGGGGTCGG - Intergenic
1090449017 11:126789775-126789797 CAGGAAGACTGGGAAGGGGCTGG - Intronic
1091219563 11:133922017-133922039 TAGAAACACTGAGATGGGGCTGG + Intronic
1091836337 12:3588744-3588766 CAGAGAGACTGTGATGGGGAAGG + Intronic
1096216525 12:49800869-49800891 TGAGAAGAGTGTGCTGGGGTGGG + Intronic
1096442889 12:51660866-51660888 TGGGAAGACTGTGGAGGAGTAGG + Intronic
1097241274 12:57576973-57576995 TGGGAAAAATATGATGGGGTAGG + Intronic
1098396150 12:70018906-70018928 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1099181465 12:79475702-79475724 TAGGAACAATATCATGGGGTGGG - Intergenic
1099184141 12:79499350-79499372 TGGGAAGACTCTGATGAAGTTGG - Intergenic
1100272676 12:93041366-93041388 TAGAGAGAGAGTGATGGGGTTGG - Intergenic
1100397315 12:94196387-94196409 GAGCAAGACTGTGAGGGGGCAGG - Intronic
1100661147 12:96700264-96700286 TTGGAAGAGTGTCATGGGGGAGG + Intronic
1101188617 12:102307930-102307952 TCTGAGGACTGTTATGGGGTCGG - Intergenic
1101574381 12:105983932-105983954 TAGGATGACTTTGAGGGAGTGGG + Intergenic
1102740314 12:115201095-115201117 TAGGAAGACTGGGGTTGAGTTGG + Intergenic
1103357495 12:120332478-120332500 TAGGAAGGCTTTCATGGGCTGGG - Intergenic
1103722807 12:122983651-122983673 CGTGAAGGCTGTGATGGGGTGGG + Exonic
1104104695 12:125648058-125648080 TCTGGGGACTGTGATGGGGTGGG - Intronic
1104590299 12:130079397-130079419 TAAGAAGAGTGAGATGAGGTTGG + Intergenic
1105482749 13:20793900-20793922 CAGGAAGGCTGTGCTGGGGGAGG + Intronic
1106179612 13:27359434-27359456 TAAGAAGACAGTGATAGTGTGGG - Intergenic
1106273493 13:28178831-28178853 CAAGAAGACTGTGGTGGTGTTGG + Intronic
1107938629 13:45365473-45365495 TGGGAGGGCTGTGGTGGGGTTGG - Intergenic
1108157801 13:47604352-47604374 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1109355832 13:61229475-61229497 TAGGAAAAATTTCATGGGGTGGG + Intergenic
1110897554 13:80773939-80773961 AAGGAAGACAGTGAATGGGTGGG - Intergenic
1113161058 13:107381567-107381589 TAGGAAGAGTGGGAGTGGGTGGG - Intronic
1116541403 14:46106908-46106930 CATGCTGACTGTGATGGGGTGGG + Intergenic
1117108841 14:52427657-52427679 TAGGAAAGCTGGGATGGTGTTGG - Intergenic
1119773517 14:77235691-77235713 TGGGGAGACTGTGATGGGTGGGG + Intronic
1119773534 14:77235743-77235765 TGGGGAGACTGTGATGGGTGGGG + Intronic
1119773626 14:77235998-77236020 TGGGGAGACTGTGATGGGTGGGG + Intronic
1119773633 14:77236025-77236047 TAGGGAGACTGTGATGGGTGGGG + Intronic
1119773669 14:77236132-77236154 TAGGGAGACTGTGATGGGTGGGG + Intronic
1119773697 14:77236211-77236233 TGGGGAGACTGTGATGGGTGGGG + Intronic
1119773727 14:77236289-77236311 TAGGGAGACTGTGATGGGTGGGG + Intronic
1119773736 14:77236315-77236337 TGGGGAGACTGTGATGGGTGGGG + Intronic
1119773771 14:77236418-77236440 TAGGGAGACTGTGATGGGTGGGG + Intronic
1119773795 14:77236497-77236519 TGAGGAGACTGTGATGGGCTGGG + Intronic
1121131692 14:91453315-91453337 TTGGAAGACTGGAATGGGATAGG - Intergenic
1122377346 14:101272051-101272073 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1122395146 14:101421722-101421744 TAGGAAGAATTTTATGTGGTTGG - Intergenic
1123105250 14:105838290-105838312 TAGGAAGTCTGTGACGTGGCTGG - Intergenic
1124199705 15:27668518-27668540 TATCAAGACTGTGATTGGGCTGG + Intergenic
1124605515 15:31167666-31167688 CAGGGAGACTGGGATGGGGTTGG - Intergenic
1125864799 15:43035915-43035937 TCTGGAGACTGTGGTGGGGTGGG + Intronic
1126298032 15:47163266-47163288 TGGTAACACTGTAATGGGGTGGG - Intergenic
1126645486 15:50871052-50871074 AAGGAAGACTGTAATTGGGGTGG + Intergenic
1128014655 15:64332510-64332532 TCTGGGGACTGTGATGGGGTGGG + Intronic
1128075370 15:64822434-64822456 TAGGGGGACAGTGGTGGGGTGGG - Intronic
1129391714 15:75224075-75224097 GAGGAAGACTGAAAAGGGGTCGG - Intergenic
1129412658 15:75358599-75358621 TAGGAAGCCTGTGCTGGGCCAGG - Exonic
1129626504 15:77205981-77206003 TCTGGGGACTGTGATGGGGTGGG - Intronic
1130188782 15:81712055-81712077 TAGGAAGACTGTTATGGAGGGGG - Intergenic
1130206393 15:81879531-81879553 TAGGTAGATTGGGATTGGGTGGG - Intergenic
1130390587 15:83450960-83450982 TCTGGAGACTGTGGTGGGGTCGG - Intronic
1130461433 15:84160247-84160269 TAGGAAGGCTGGGATAGGGCAGG - Intergenic
1132028689 15:98423077-98423099 TAGGCTGAATGTGATGGGGATGG - Intergenic
1132051614 15:98612203-98612225 TCTGAAGGCTGTGATGAGGTGGG + Intergenic
1133456029 16:5943245-5943267 TAAGAAGCCTGTGATGGGCTGGG - Intergenic
1134552657 16:15145166-15145188 TAGGAAGAGGGTGGTGGGGGGGG + Intergenic
1135425215 16:22329317-22329339 TAGTCATACTGTGATGGGGAGGG + Intronic
1135553386 16:23415679-23415701 TATTAAGACTGTGATGGGCATGG - Intronic
1135845283 16:25913123-25913145 AAGGCAGATTCTGATGGGGTTGG + Intronic
1136455589 16:30378192-30378214 CCGGAAGACAGTGATGCGGTCGG + Exonic
1137725761 16:50655507-50655529 TGGGATAACTGTGAGGGGGTGGG + Intergenic
1137893488 16:52186273-52186295 TAGGAGGACTGAGATGGAGCAGG - Intergenic
1138250090 16:55495349-55495371 AAAGAAAACTGTGATGTGGTAGG - Intronic
1138915809 16:61462949-61462971 TCTGGGGACTGTGATGGGGTGGG + Intergenic
1139086169 16:63588840-63588862 TAGGAAGACAGAGATGGGATTGG - Intergenic
1141066715 16:80919944-80919966 TGGGAAAACTGTGATGGAGCGGG + Intergenic
1141797096 16:86282414-86282436 TAGGAAGGCTGTCAGGGGGTTGG + Intergenic
1142429150 16:90017032-90017054 TGGGCAGACTGAGTTGGGGTGGG + Intronic
1142752560 17:1997808-1997830 TAGGAGGGCTGTGAAGGGGGCGG - Intronic
1146940049 17:36838149-36838171 GAGGAAAACTGTGATGGGGAAGG - Intergenic
1147186483 17:38716039-38716061 AAGGAATACTGTTATGAGGTTGG - Intronic
1147595267 17:41712622-41712644 TGGGAAGAGTGTGAAGGGATAGG - Intronic
1148101196 17:45092814-45092836 TAGGAACACTGTTACTGGGTTGG + Intronic
1148431863 17:47649680-47649702 GAGGGAGATTGGGATGGGGTAGG - Intronic
1148964461 17:51422944-51422966 TTGGCAGACTGTGATGAGGCAGG + Intergenic
1149609704 17:57951102-57951124 TTGGAAGAGTGGGAGGGGGTGGG - Intronic
1151191165 17:72399190-72399212 TATGAAGACTCAGATGGGATAGG + Intergenic
1151367469 17:73626740-73626762 TAGGAAGACAGCGATGGAATGGG + Intronic
1151859322 17:76748070-76748092 TAGGAAGACTGTGAAAGAGGGGG + Intronic
1151986187 17:77545338-77545360 TGGGAAGGCTGGGATGGGGAGGG + Intergenic
1154285020 18:13046371-13046393 TAGAAAGACTGTGATATAGTTGG - Intronic
1156239725 18:35241128-35241150 TAGGAAGAGGGAGGTGGGGTTGG + Intronic
1156995955 18:43466845-43466867 GAGGAAGACAGTGAAGGGGAAGG + Intergenic
1157241582 18:46014944-46014966 TAGGCAGACTGAGAAGGGCTAGG + Intronic
1157525443 18:48376936-48376958 TATGGAGACTGTGGTGGGGATGG - Intronic
1158017135 18:52797576-52797598 TGGTAAGACTTTGATGGGGGTGG + Intronic
1158371442 18:56810323-56810345 TTGGAAGACAGTAAAGGGGTAGG - Intronic
1160802174 19:975139-975161 TATGCAGACTGGGAGGGGGTCGG + Exonic
1161412131 19:4122904-4122926 TAATGAGACTGAGATGGGGTAGG - Intronic
1162377965 19:10316261-10316283 TGGGGAGACTGGGGTGGGGTCGG + Exonic
1162873931 19:13606930-13606952 TTGGAAGCCTGTAATGGGATGGG - Intronic
1163082987 19:14956835-14956857 GGGGAAGACTGGGATGGAGTAGG - Intronic
1163251934 19:16131222-16131244 TGGGAAGGGTATGATGGGGTGGG + Intronic
1164704272 19:30308411-30308433 TCTGAAGACTGAAATGGGGTGGG + Intronic
1164755660 19:30687059-30687081 TAGCAAGACTGTGATACTGTGGG + Intronic
1164866409 19:31607828-31607850 AAGTAAGAGTGTGATGGGGAAGG - Intergenic
1165700212 19:37931829-37931851 CAGGAAGAAAGTGCTGGGGTGGG - Intronic
1165831469 19:38732717-38732739 TGGGGTGACTGTGATGGAGTCGG - Intronic
1166642916 19:44509966-44509988 TAAGAAGACTGAAATGGGATGGG + Intronic
1167101702 19:47407674-47407696 TAGAGAGACTGTGTTGGGGGAGG + Intronic
1167566600 19:50261199-50261221 TAGGAAGGGGGTGATGGGGCAGG - Intronic
1168058769 19:53879023-53879045 TAAGAAGACAGCGATGGAGTGGG - Intergenic
1168067942 19:53930100-53930122 TAGGAGGAGAGTGATGGGGAGGG + Intronic
1168480649 19:56717037-56717059 TAGGAACAATGGGATGGTGTAGG - Intergenic
925858946 2:8156657-8156679 GAGGTAGACTGTGAAGGGCTTGG + Intergenic
927297084 2:21467195-21467217 TAGGCAGGCTGTGATGAGTTGGG + Intergenic
928217366 2:29372874-29372896 CAGGAAGACGGAGATGGTGTGGG + Intronic
928780974 2:34819944-34819966 TCTGAGGACTGTGGTGGGGTCGG + Intergenic
929438816 2:41949364-41949386 AAGGAAGACTGGAATGGGGTGGG + Intronic
929660546 2:43780055-43780077 TAGGAAGAGGCTGATGGAGTAGG + Intronic
931417600 2:62096447-62096469 AAGGAAGACTATGATTGGGATGG + Intronic
932614454 2:73223176-73223198 TTTCAAGACTGGGATGGGGTAGG + Intronic
936907016 2:117548503-117548525 TCTGAGGACTGTTATGGGGTGGG + Intergenic
938029603 2:127981329-127981351 CAGGAGGACTGGGTTGGGGTGGG - Intronic
938642132 2:133292072-133292094 TAAGAAGAATGGGATGGGGTTGG + Intronic
941705085 2:168649798-168649820 GGGAAAGAGTGTGATGGGGTAGG - Intronic
944027354 2:195187178-195187200 TCGGGGGACTGTGGTGGGGTCGG + Intergenic
944618274 2:201484607-201484629 TCGGGGGACTGTGGTGGGGTGGG + Intergenic
945138226 2:206653815-206653837 TGGGAAAACTGTTATGCGGTTGG - Intronic
948125092 2:235558647-235558669 TAGGAACAATGTTATGGGATGGG + Intronic
948293908 2:236847082-236847104 GAGGCAGACTGTGTTGGGCTGGG + Intergenic
948440245 2:237982328-237982350 TGCTAAGACTGTGATGTGGTAGG - Intronic
948817366 2:240519259-240519281 ACGGAAAATTGTGATGGGGTTGG + Intronic
1168805288 20:669115-669137 TAGTTAGCCTGTGGTGGGGTGGG + Intronic
1169613493 20:7411287-7411309 GAGGAAGACAGTGAAGGGGGAGG - Intergenic
1169942219 20:10949544-10949566 TAGGAGGGTTGTGATGGGGAGGG + Intergenic
1169974009 20:11302862-11302884 GAGGAAGTTGGTGATGGGGTGGG + Intergenic
1171943334 20:31352176-31352198 TCTGAGGACTGTGGTGGGGTGGG + Intergenic
1172529095 20:35618137-35618159 TGGGGAGACTGTCTTGGGGTAGG + Intronic
1173371815 20:42443310-42443332 TAAGAAGACTGTGATTCAGTGGG + Intronic
1175881501 20:62262091-62262113 TAGGCAGAGGGTGACGGGGTGGG - Intronic
1178909902 21:36666087-36666109 TTGGAAGACTGTGCAGGGGAAGG + Intergenic
1179036059 21:37759558-37759580 TGGGAAGCCAGTGATGGGGATGG - Intronic
1179587940 21:42385652-42385674 AAGGAAGCCTTTGATGGGTTTGG - Intronic
1180882824 22:19218664-19218686 TAGGCAGACTGTTTAGGGGTGGG - Intronic
1181754398 22:25013039-25013061 TGGGTAGAGTGGGATGGGGTTGG + Intronic
1182283401 22:29230992-29231014 GAGGAAGACAGGGACGGGGTGGG - Intronic
1182750770 22:32640547-32640569 TATGAAGACTGTGAGGAGCTGGG - Intronic
1183640559 22:39090101-39090123 TGGGAAGACTGAGATGGAGGTGG + Intergenic
1183890266 22:40921527-40921549 TAGTAATACTGTGGTGGGCTGGG + Intronic
1183926630 22:41211013-41211035 TAGGAGGACTGGGTTGGGGGCGG + Intronic
949360922 3:3231333-3231355 GAGGAAGAGAGTGACGGGGTAGG + Intergenic
949509407 3:4755132-4755154 TAGGAAGCCCCTGATGGTGTAGG - Intronic
949888371 3:8713993-8714015 AAGGAAGACTGAGAGGGGGTAGG + Intronic
952466881 3:33598324-33598346 TAAGAAGAGTGTGATTGGGGAGG - Intronic
953789684 3:45937779-45937801 GAGGAAGACAGAGAGGGGGTTGG - Intronic
956239065 3:67108679-67108701 GGGGAAGAGTGAGATGGGGTTGG - Intergenic
957221941 3:77394077-77394099 TTGAAAGACTGTTATGGTGTTGG - Intronic
958118923 3:89259306-89259328 TAAAAAGACTGTGATGTGATAGG - Intronic
958200338 3:90307230-90307252 TCTGGAGACTGTGGTGGGGTGGG - Intergenic
958785854 3:98595269-98595291 CTGGATGCCTGTGATGGGGTTGG + Intergenic
959611622 3:108301528-108301550 GAGGAAAATTGTGGTGGGGTGGG - Intronic
960252290 3:115469490-115469512 TCTGGGGACTGTGATGGGGTGGG + Intergenic
962333656 3:134505439-134505461 TAGCAAGGCTCTGCTGGGGTAGG + Intronic
963322684 3:143826425-143826447 AAGGAAGGCTGTGAAGGGCTTGG - Intronic
963551764 3:146732905-146732927 TCTGGAGACTGTGGTGGGGTCGG - Intergenic
963789987 3:149573904-149573926 AAGGAAGAGTTTGATGGAGTGGG - Intronic
964645827 3:158957448-158957470 TCTGAGGACTGTGGTGGGGTGGG - Intergenic
964720280 3:159763551-159763573 GAGGCAGGCTGGGATGGGGTTGG - Intronic
966830626 3:184005149-184005171 TAGGCAGACTATGCTGGGGCTGG - Intronic
966841438 3:184091762-184091784 TAGGTAGGCTGAGAAGGGGTTGG - Intergenic
967068560 3:185942117-185942139 TAGGGAGACTATGAAAGGGTGGG + Intergenic
967910424 3:194538110-194538132 TAGAAAGACAGTGACGGGGTCGG + Intergenic
968353752 3:198083057-198083079 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
969691883 4:8708475-8708497 TGGGAACCCTGGGATGGGGTGGG + Intergenic
970661612 4:18291992-18292014 TATGAATACAGTGATGTGGTAGG + Intergenic
972740173 4:41880837-41880859 TAGAAAGAATGTGACGGGGATGG + Intergenic
973577307 4:52303092-52303114 GAGGAGGATTGTAATGGGGTGGG + Intergenic
974898381 4:67967568-67967590 TCTGCAGACTGTGGTGGGGTGGG - Intergenic
975267867 4:72392389-72392411 TAGGAAGTTTGTGATGGGATAGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976468007 4:85393407-85393429 AAGGATGACTGTGAGGGCGTGGG + Intergenic
977067158 4:92332857-92332879 TGGGAAAACTGGGGTGGGGTTGG + Intronic
977756431 4:100677333-100677355 TCTGAGGACTGTGGTGGGGTGGG - Intronic
979144843 4:117232552-117232574 AAGCACAACTGTGATGGGGTTGG - Intergenic
980224344 4:129962225-129962247 TCTGAGGACTGTTATGGGGTGGG - Intergenic
983310507 4:166054570-166054592 TGTGAGGACTGTGGTGGGGTGGG - Intronic
983443727 4:167821598-167821620 GAGGAAGACAGTGAAGGGGGAGG - Intergenic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
983809295 4:172038625-172038647 TTTGAAGACAGTGATGGGGCTGG - Intronic
984370479 4:178858694-178858716 TCTGGAGACTGTGGTGGGGTAGG - Intergenic
984449351 4:179879106-179879128 AAGGCAGACAGTGATGGGGAAGG + Intergenic
985183175 4:187287456-187287478 TAGGGAGACAGAGATGGGGGTGG + Intergenic
985249947 4:188013666-188013688 TAGTAAAACTGAGATGAGGTTGG + Intergenic
986462183 5:7983574-7983596 TAGGGAGCCTGAGATGAGGTCGG + Intergenic
987298361 5:16574399-16574421 CAGGAAGGATGTGACGGGGTAGG + Intronic
988785776 5:34564449-34564471 TAGGGAGTCTGTGGAGGGGTGGG - Intergenic
990801121 5:59604762-59604784 TATGCAGATTGTGAGGGGGTGGG + Intronic
991196850 5:63944194-63944216 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
991941216 5:71853999-71854021 TCTGGGGACTGTGATGGGGTGGG + Intergenic
992620301 5:78585831-78585853 TGGGGAGACTGGGTTGGGGTTGG + Intronic
993016663 5:82542413-82542435 TAGGAAAAAAGTGATAGGGTTGG - Intergenic
996954644 5:129168367-129168389 TTAGAAGACTGTGATGTGGAAGG - Intergenic
997940597 5:138153970-138153992 TAAGAAAATGGTGATGGGGTCGG - Intronic
997966278 5:138358948-138358970 TCTGAAGACTGTTGTGGGGTAGG - Intronic
998563677 5:143196236-143196258 GAAGAGGACTGTGATGGGGGAGG - Intronic
999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG + Intronic
1001043782 5:168355717-168355739 TGGTAAGACTTTGAAGGGGTTGG + Intronic
1001074949 5:168619274-168619296 AAGGAAGATAGTGATGGGCTTGG - Intergenic
1001449264 5:171811609-171811631 TAAGAAGGATGTGATGGGGCTGG - Intergenic
1002715398 5:181223827-181223849 AGGGAACACTGTGTTGGGGTGGG + Exonic
1004208418 6:13614295-13614317 TGGGCAGAGTGGGATGGGGTAGG + Exonic
1004870410 6:19898531-19898553 GAGGATGACAGTGATGGCGTTGG - Intergenic
1004931161 6:20464454-20464476 CAGGAACACTGTAATGGGGATGG - Intronic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1006673616 6:35746156-35746178 AAGGAAGGCTGGGATGGGGGTGG + Intronic
1007581936 6:42965039-42965061 GAGGAAGACTGCGAAGGGCTTGG - Intronic
1007609083 6:43137365-43137387 TAGAACGAGTGTGATGGGGGTGG + Intronic
1008483703 6:52012830-52012852 TACGAAGAATGTGATGGTGTGGG - Intronic
1009341448 6:62559562-62559584 TCTGAAGACTGTTGTGGGGTGGG + Intergenic
1010019820 6:71146188-71146210 TCTGAGGACTGTGGTGGGGTGGG + Intergenic
1010036268 6:71329074-71329096 AAGGAATAGGGTGATGGGGTGGG + Intergenic
1010531720 6:76976732-76976754 TCTGAGGACTGTGGTGGGGTGGG - Intergenic
1012175444 6:96076242-96076264 TAGGAAGACTATTTTGGGCTGGG + Intronic
1014033953 6:116743747-116743769 TTGGGAGACTGAGGTGGGGTGGG - Intergenic
1014062779 6:117092366-117092388 TCTGGAGACTGTTATGGGGTGGG - Intergenic
1014077362 6:117250606-117250628 TCTGGAGACTGTTATGGGGTGGG + Intergenic
1014368294 6:120573006-120573028 TAAGAAGACTTTGATGGTGAGGG - Intergenic
1016295510 6:142569182-142569204 AAGGAAGACTATAATGTGGTTGG - Intergenic
1016566440 6:145460369-145460391 TGGGAAGACTGTGATCAGGAAGG - Intergenic
1017496348 6:154987166-154987188 TAGGAAGACTGTGCTGCTGAGGG + Intronic
1017641923 6:156502883-156502905 TAGGAAGACTGGGAGTGTGTGGG - Intergenic
1018174642 6:161168113-161168135 CAGGAAGGCGGTGGTGGGGTGGG + Intronic
1018532448 6:164782113-164782135 TCTGGGGACTGTGATGGGGTGGG - Intergenic
1018746213 6:166764309-166764331 AAGGAAGACTGTGAGGCGGGAGG + Intronic
1019688962 7:2399065-2399087 AAGAAAGACAGGGATGGGGTGGG + Intergenic
1019785014 7:2971160-2971182 AAGGAAGGTTGTGATGCGGTCGG - Intronic
1021594506 7:22300857-22300879 TTTGAAGAGTGTGATGGGGTGGG - Intronic
1022566934 7:31413187-31413209 GAGGAAGCTTGTGATGGGGAAGG + Intergenic
1023373711 7:39535876-39535898 TAGGAAGGCTGGGCTGGGCTGGG + Intergenic
1023802179 7:43844732-43844754 CAGGAAGACTGTCCTGGAGTTGG + Intergenic
1024303255 7:47904129-47904151 AAGGAGGCCTGTGATGTGGTGGG - Intronic
1024955934 7:54920583-54920605 TGGTAAGACTGTGATTGGGCAGG + Intergenic
1025275735 7:57580298-57580320 TAGTAGAAATGTGATGGGGTAGG + Intergenic
1025501605 7:61308115-61308137 TCGGGGGACTGTGGTGGGGTCGG - Intergenic
1025516467 7:61654337-61654359 TCGGGGGACTGTGGTGGGGTCGG - Intergenic
1025540804 7:62083162-62083184 TCGGGGGACTGTGGTGGGGTCGG - Intergenic
1026335347 7:69389672-69389694 TGGGAAGGCTGAGGTGGGGTAGG + Intergenic
1026766271 7:73161858-73161880 GAGGAAGTCTGTGCTGGGATAGG - Intergenic
1027042744 7:74971554-74971576 GAGGAAGTCTGTGCTGGGATAGG - Intronic
1027080898 7:75230803-75230825 GAGGAAGTCTGTGCTGGGATAGG + Intergenic
1027891986 7:83989472-83989494 TCTGGAGACTGTGGTGGGGTGGG - Intronic
1031676905 7:124621378-124621400 TATGGAGACTGTTGTGGGGTGGG - Intergenic
1032967571 7:137118615-137118637 TCTGGGGACTGTGATGGGGTGGG - Intergenic
1036452968 8:8884566-8884588 GAGGAACACTGTGAGGGGGAGGG + Intronic
1038345312 8:26726869-26726891 TAAGAAGACTCTGATAGGGCAGG - Intergenic
1038383534 8:27119468-27119490 TCTGGGGACTGTGATGGGGTCGG + Intergenic
1038527881 8:28292458-28292480 TCTGAGGACTGTGGTGGGGTCGG - Intergenic
1038637929 8:29302353-29302375 TAGGAAGAGTATGACAGGGTTGG + Intergenic
1038702317 8:29860149-29860171 GAGGAAGTCAGTGATGGGATGGG - Intergenic
1039566955 8:38558686-38558708 CAGCCAGAATGTGATGGGGTGGG + Intergenic
1041194204 8:55384227-55384249 TTGGAAGAATGTGTTGGAGTCGG + Intronic
1041306075 8:56462478-56462500 TAGGAAGCCTTTGGTGGGATGGG + Intergenic
1041499396 8:58523541-58523563 TAGGTAAACTGTCATGGTGTTGG - Intergenic
1041612635 8:59869953-59869975 TCTGGGGACTGTGATGGGGTGGG - Intergenic
1044333871 8:90952924-90952946 TAGTAATACTGTAATAGGGTAGG - Intronic
1044369668 8:91394160-91394182 TAGAAAGTCTGAGGTGGGGTGGG - Intronic
1044513700 8:93114048-93114070 AAGGAAGACTGTGAAGAGATTGG - Intergenic
1045074281 8:98545365-98545387 TAGGAAGACTGGGAGCGGGAGGG + Intronic
1045265613 8:100616429-100616451 TAGGAAGGCAGTGATAGAGTGGG - Intronic
1045826532 8:106404315-106404337 TAGGAAAACTCTGATGAAGTTGG - Intronic
1046117586 8:109802931-109802953 TTGGAAGACTGAGAAGGAGTTGG + Intergenic
1048394358 8:133999870-133999892 TGGGAAGACAGAGATGGGGAAGG + Intergenic
1048692536 8:136983796-136983818 TAAGAGGAGTGTGATGAGGTGGG - Intergenic
1049443076 8:142618010-142618032 TATGAAGACAGTGATGTGGGGGG - Intergenic
1049713833 8:144080179-144080201 AGGGAAGGGTGTGATGGGGTTGG + Intronic
1050742868 9:8842561-8842583 TAGGGAGACTGTGGAGAGGTAGG + Intronic
1051307632 9:15731221-15731243 TAGGAAGGGTGTGTTGGGGGAGG - Intronic
1051673511 9:19536356-19536378 TCTGGAGACTGTGGTGGGGTCGG - Intronic
1052961813 9:34304507-34304529 TAGGTAGACAGTGATTGGATAGG + Intronic
1053593009 9:39533264-39533286 TATGCAGACTGGGATGGGGTCGG - Intergenic
1053850747 9:42287972-42287994 TATGCAGACTGGGATGGGGTCGG - Intergenic
1054425986 9:65067845-65067867 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1054573297 9:66832013-66832035 TATGCAGACTGGGATGGGGTCGG + Intergenic
1054578201 9:66883722-66883744 TATGGGGACTGTGGTGGGGTGGG + Intronic
1056251070 9:84748661-84748683 TAAGAAAACTGCGATGGGGGAGG - Intronic
1056835708 9:89953587-89953609 TATGGGGACTGTGGTGGGGTGGG + Intergenic
1059347424 9:113639051-113639073 TATGACAACTGTGATGTGGTGGG - Intergenic
1060747762 9:126148983-126149005 TAAGAAGTTTGTGGTGGGGTGGG - Intergenic
1062697215 9:137881554-137881576 TAGGAAGCAGGTGAAGGGGTGGG - Intronic
1185744720 X:2563550-2563572 TAGAAATACTGTGTTGTGGTAGG + Intergenic
1187209525 X:17215365-17215387 TAGGAAGAGTGGGATGGGAAGGG + Intergenic
1187266183 X:17736728-17736750 TAGGAGGACTGTGTTGGAGCTGG + Intergenic
1188291221 X:28391225-28391247 TCTGAGGACTGTGGTGGGGTGGG + Intergenic
1188308402 X:28586728-28586750 TGGGGAGACAGTGATGGGGGTGG + Intergenic
1190154049 X:47973373-47973395 TGGGAAGACTGTGCTGGAATGGG - Intronic
1190201363 X:48364397-48364419 TAGAAAGACTGGGATGGGCGCGG + Intergenic
1190334290 X:49253075-49253097 GAGGAAGACAAAGATGGGGTGGG - Intronic
1190903903 X:54707314-54707336 TAAGAAGAATGTAATGGAGTTGG - Intergenic
1191680383 X:63834089-63834111 TAGGAATACTGGGTTGGAGTGGG + Intergenic
1192148152 X:68695248-68695270 TGGGAAGAGTGTGATGGGAAGGG + Intronic
1192345299 X:70298338-70298360 TTGGAAGGCTGAGGTGGGGTGGG - Intronic
1192940751 X:75909436-75909458 TGGGAAGACTCTGATGACGTTGG + Intergenic
1192974940 X:76273256-76273278 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1193143919 X:78057981-78058003 TAGGAAGACTGGAAGGGGGAGGG + Intergenic
1193844026 X:86446449-86446471 TCTGGGGACTGTGATGGGGTCGG - Intronic
1194881311 X:99254815-99254837 GAGGAAGAGAGTGAAGGGGTAGG + Intergenic
1195250968 X:103046755-103046777 GAGGAAGAGTGAGATGGGGGAGG - Intergenic
1195757163 X:108210878-108210900 TTGGAAGGCAGTGATGGGGGTGG - Intronic
1196986302 X:121275978-121276000 TAGGAAGAGTGTGAGGGGCTCGG + Intergenic
1197206336 X:123793964-123793986 GAGGAAGAAAGAGATGGGGTAGG - Intergenic
1198276577 X:135099652-135099674 TGTGAAAACTGGGATGGGGTCGG - Intergenic
1198309917 X:135421085-135421107 TGTGAAAACTGGGATGGGGTTGG + Intergenic
1199403634 X:147429788-147429810 GAGGAAGAGAGTGAAGGGGTGGG + Intergenic
1199440664 X:147864455-147864477 TTGGATGACTGTTGTGGGGTGGG + Intergenic
1200240706 X:154491698-154491720 TGTCAAGACTGTGATGGAGTCGG + Intergenic
1200962818 Y:9010730-9010752 TCTGGAGACTGTGGTGGGGTGGG + Intergenic
1202377826 Y:24254887-24254909 TAGGAAGGCTGGGATAGGGCAGG + Intergenic
1202492956 Y:25415234-25415256 TAGGAAGGCTGGGATAGGGCAGG - Intergenic