ID: 1086930932

View in Genome Browser
Species Human (GRCh38)
Location 11:92692214-92692236
Sequence CAGCTTTAACACCCATGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086930932 Original CRISPR CAGCTTTAACACCCATGCAT TGG Intronic
907053232 1:51343900-51343922 CTGCTTTAACACCCTTCCATAGG - Intronic
907694679 1:56711482-56711504 CAGCTTTTACAACCATTAATAGG - Exonic
914447904 1:147765680-147765702 GGGCTTTAACAGCCATGCCTAGG + Intronic
915849325 1:159304299-159304321 CATTTTTAAGACCCCTGCATTGG + Intronic
916827009 1:168452143-168452165 AAGCTTAAAGCCCCATGCATAGG + Intergenic
919606161 1:199687440-199687462 CAGCGTTAGCAACCATGCACAGG + Intergenic
921305208 1:213789469-213789491 CAGCTGTTAAACCCAGGCATAGG - Intergenic
924248463 1:242107605-242107627 CAGCTTTCACACACATGCAGAGG + Intronic
924868593 1:248014534-248014556 CTGCTTTAAGAACCATGCAGTGG + Intronic
1064499889 10:15959445-15959467 CGACTTTAACTCCAATGCATTGG - Intergenic
1064735234 10:18375435-18375457 GAGCTTTCAGACCTATGCATTGG + Intronic
1065587310 10:27232303-27232325 GAGCTGTAACACTCAGGCATGGG + Intronic
1067270737 10:44789344-44789366 CAGCTTTAACTCTCATGTCTGGG + Intergenic
1067960964 10:50848902-50848924 CAACTTTAAGAACCATGCACAGG - Intronic
1070322236 10:75362964-75362986 CAGCTTTCACACCCAGGGGTGGG - Intergenic
1074218186 10:111408761-111408783 CAACTTTAACACCCTTGCCTAGG - Intergenic
1076353165 10:129832526-129832548 CACCTTTCTCACCCCTGCATGGG - Intergenic
1078325860 11:10380357-10380379 CAGCTGTTACCCCCATGCCTGGG + Intronic
1079589927 11:22169840-22169862 CAGCTTTAAAATACATACATGGG - Intergenic
1083102474 11:60323290-60323312 CAGCTTTATCGTCCTTGCATAGG - Intergenic
1086843758 11:91721750-91721772 CAACTCGAACACCCATGCACTGG - Intergenic
1086930932 11:92692214-92692236 CAGCTTTAACACCCATGCATTGG + Intronic
1087024101 11:93632860-93632882 CAGCTTTCACATCTATGAATGGG - Intergenic
1090340560 11:126016358-126016380 CAATTTTATCACCCAGGCATTGG + Intronic
1098474442 12:70883974-70883996 CAGTGTTAACAGCCATGCATGGG + Intronic
1108877465 13:55063852-55063874 CTGCTTAAAAACCCATGCTTTGG - Intergenic
1112037089 13:95506857-95506879 CAGCACTCACACCGATGCATGGG + Intronic
1114379619 14:22187887-22187909 CAGCTTTAACAACCATCAACTGG + Intergenic
1116425603 14:44786631-44786653 CAGCTTTCACATCCAAGCAGTGG - Intergenic
1125002767 15:34788549-34788571 CTGGTTTAAAAGCCATGCATGGG - Exonic
1126331662 15:47538877-47538899 CACCTTTAACAACCATGCAGAGG + Intronic
1129165129 15:73772764-73772786 CACCTTTGTCCCCCATGCATGGG + Intergenic
1129165134 15:73772775-73772797 CAGTTTCTCCACCCATGCATGGG - Intergenic
1130101382 15:80896922-80896944 CATCTTTAAGAACCATGCTTAGG + Intronic
1131593393 15:93772943-93772965 CAGTTTCAACACCTTTGCATGGG + Intergenic
1134166216 16:11931956-11931978 CAGCTTTTGCACACATGCGTGGG + Intronic
1134435565 16:14253319-14253341 CACCTTTAGCACCCATGGAGCGG - Intronic
1134526429 16:14947508-14947530 CAGCTTTTGCACACATGCGTGGG - Intronic
1134545975 16:15108838-15108860 CAGCTTTTGCACACATGCGTGGG + Intronic
1134580695 16:15368161-15368183 CAGCTTTTGCACACATGCGTGGG + Intronic
1134714006 16:16345981-16346003 CAGCTTTTGCACACATGCGTGGG - Intergenic
1134721879 16:16389344-16389366 CAGCTTTTGCACACATGCGTGGG - Intronic
1134945546 16:18322525-18322547 CAGCTTTTGCACACATGCGTGGG + Intronic
1134952811 16:18362677-18362699 CAGCTTTTGCACACATGCGTGGG + Intergenic
1135311607 16:21409381-21409403 CAGCTTTTGCACACATGCGTGGG + Intronic
1135364559 16:21841833-21841855 CAGCTTTTGCACACATGCGTGGG + Intronic
1135447284 16:22529516-22529538 CAGCTTTTGCACACATGCGTGGG - Intronic
1136150772 16:28347290-28347312 CAGCTTTTGCACACATGCGTGGG + Intronic
1136167009 16:28461128-28461150 CAGCTTTTGCACACATGCGTGGG + Intronic
1136195967 16:28653904-28653926 CAGCTTTTGCACACATGCGTGGG - Intronic
1136212305 16:28768027-28768049 CAGCTTTTGCACACATGCGTGGG - Intronic
1136257028 16:29047939-29047961 CAGCTTTTGCACACATGCGTGGG - Intronic
1136308312 16:29388377-29388399 CAGCTTTTGCACACATGCGTGGG + Intronic
1136321729 16:29489915-29489937 CAGCTTTTGCACACATGCGTGGG + Intronic
1136436409 16:30229885-30229907 CAGCTTTTGCACACATGCGTGGG + Intronic
1136464159 16:30430384-30430406 CTGATTTAATACCTATGCATAGG - Intergenic
1137600265 16:49751739-49751761 AAGCAGTACCACCCATGCATGGG + Intronic
1138711223 16:58972229-58972251 CAGCTTTAGCAGCAATGCACTGG + Intergenic
1139184361 16:64788004-64788026 CAGAGTTAACACCCATGAAAAGG - Intergenic
1140366720 16:74387274-74387296 CAGCTTTTGCACACATGCGTGGG - Intronic
1143261011 17:5598249-5598271 CAGCTATAACAACCAGGCAGAGG + Intronic
1148834995 17:50461318-50461340 CTGCATGAGCACCCATGCATAGG - Exonic
1149121271 17:53168662-53168684 CAGTTTTCACACCCATACAGTGG + Intergenic
1150089950 17:62314718-62314740 CAGATTTAACAGTCATACATTGG - Intergenic
1153934258 18:9906708-9906730 CAGCCTAAACGCCTATGCATGGG + Intergenic
1154117479 18:11624013-11624035 CAGCTTTTGCACACATGCGTGGG + Intergenic
1154456548 18:14532782-14532804 CAAGTATAACACCTATGCATGGG - Intronic
1155099236 18:22592685-22592707 CAGCTTTGATACCCCAGCATAGG - Intergenic
1161123551 19:2543561-2543583 CAGCATTAAAACCCGTGCAGAGG + Intronic
928924754 2:36566054-36566076 CATCCTTAACACCCATGCCAGGG + Intronic
929065315 2:37967270-37967292 CAGTTTTAGCACCCATTCAATGG - Intronic
931215567 2:60239931-60239953 CAGTTTTGACACCCATCCAGTGG - Intergenic
931224159 2:60315086-60315108 CAGTTATAACCCCCAAGCATAGG - Intergenic
933269502 2:80217874-80217896 CAGCTTGAAAACCTCTGCATAGG + Intronic
935641643 2:105296277-105296299 CAGATTTAACTAACATGCATCGG - Intronic
936488054 2:112943574-112943596 CAGGTTTAACACCAATGAAAGGG - Intergenic
938336060 2:130498805-130498827 CAAGTGTAACACCTATGCATGGG - Intronic
938353763 2:130621860-130621882 CAAGTGTAACACCTATGCATGGG + Intronic
939740086 2:145895215-145895237 CAGCTATAAAAAACATGCATGGG + Intergenic
945079234 2:206072081-206072103 CAACTTTGCCATCCATGCATGGG + Intronic
945274209 2:207971996-207972018 CAGATGTGACGCCCATGCATTGG - Intronic
946857411 2:223965956-223965978 CAGCTTTAACACCAACACTTTGG - Intronic
1170479564 20:16752643-16752665 CAGCTTCACTCCCCATGCATGGG + Intronic
1170536923 20:17349618-17349640 TAGCTCTAACACCCATGGATGGG - Intronic
1171823813 20:29877187-29877209 CAACTGTGACACCCATGCACTGG - Intergenic
1176817617 21:13620552-13620574 CAAGTATAACACCTATGCATGGG + Intronic
1182133477 22:27877833-27877855 CTGCTTAAATAACCATGCATGGG + Intronic
953469681 3:43155986-43156008 CAGCTCTGACACCCTTCCATTGG - Intergenic
965608329 3:170518830-170518852 CAGCTTTTAGCCCCATGGATGGG - Intronic
966358175 3:179104359-179104381 CAACCTTAACACTCTTGCATTGG + Intergenic
966821569 3:183928897-183928919 GATGTTTAACACACATGCATAGG + Intronic
970212548 4:13725420-13725442 TAGATCTAACAACCATGCATAGG - Intergenic
971679751 4:29681777-29681799 CAGCTTTAAAATCCCTGCAGTGG - Intergenic
975298662 4:72764595-72764617 CAGCATTTACAACCATGCAAAGG + Intergenic
993100661 5:83535786-83535808 AATCTATAACACACATGCATAGG - Intronic
999619850 5:153461669-153461691 CAGCTTTAACAGTCAAGCAGAGG + Intergenic
1002068806 5:176666178-176666200 AAACTTTAACACTCATGAATAGG - Intergenic
1003709746 6:8576080-8576102 CAACTGTAACACCAATGCTTTGG - Intergenic
1005222092 6:23598430-23598452 CAGGATTAACATCCATGCAGGGG - Intergenic
1005661467 6:28002979-28003001 CAGGTTTGACACACATGCTTTGG - Intergenic
1007366028 6:41393637-41393659 CAGATTTAAGAACCATGTATAGG - Intergenic
1007962473 6:45972779-45972801 GACCTTTAAAACCGATGCATTGG + Intronic
1009701080 6:67181916-67181938 GTGCTTTAACAACCATGAATTGG + Intergenic
1011259686 6:85457934-85457956 AAATTCTAACACCCATGCATGGG + Intronic
1014302941 6:119706188-119706210 CAGCATTAAAACCCATCTATAGG - Intergenic
1021294247 7:18884674-18884696 TAACTTTAACACACATGCAGAGG - Intronic
1025760833 7:64389664-64389686 CAGCTTTTGCACACATGCATGGG - Intergenic
1026241229 7:68577163-68577185 AAGCCTTAACACCTGTGCATGGG - Intergenic
1026628625 7:72018509-72018531 CAGCTTTACAACTTATGCATAGG + Intronic
1034056435 7:148039733-148039755 CAGCTTTTTCATGCATGCATTGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1036229799 8:6990099-6990121 CAAGTTTGACACCCATGCACAGG + Intergenic
1036232250 8:7009202-7009224 CAAGTTTGACACCCATGCACAGG + Intronic
1038179274 8:25211329-25211351 CAGTTTTATCACCCATGCACTGG + Intronic
1038966607 8:32580059-32580081 CAGCTACAAAACTCATGCATAGG - Intronic
1040082510 8:43302368-43302390 CATGTATAACACCTATGCATGGG + Intergenic
1041140524 8:54813689-54813711 CAGCATTTACACACATGCACTGG + Intergenic
1043381310 8:79705207-79705229 CAGCTTTAACAGCCACATATGGG + Intergenic
1044768819 8:95607292-95607314 TAACTTTAACATTCATGCATGGG + Intergenic
1045373000 8:101543612-101543634 CAACTTTATCACCCATCCAGAGG + Intronic
1048232006 8:132651516-132651538 CAGCTTTAACACGGATGAACTGG - Intronic
1051370558 9:16355480-16355502 CAGCTGGCACACCCATGCGTCGG - Intergenic
1052439084 9:28470116-28470138 CAGACTTAACTCCAATGCATAGG - Intronic
1057111489 9:92476301-92476323 CAGCTTTAACATCTCTCCATGGG + Intronic
1058229546 9:102408868-102408890 CAGCTTTAGCAGCAGTGCATTGG + Intergenic
1059520946 9:114941635-114941657 CTGCTTTTCCAGCCATGCATGGG - Intergenic
1060142830 9:121225458-121225480 CAGCTCTAACAGCCGTGCCTAGG - Intronic
1203529743 Un_GL000213v1:128949-128971 CAAGTATAACACCTATGCATGGG - Intergenic
1186610368 X:11132799-11132821 CAGCTATAATAGCCATGCAATGG - Intergenic
1187428412 X:19199616-19199638 CAGTATTAACACCCAAGCATAGG + Intergenic
1188606242 X:32034014-32034036 CAGCTGTAAGAGCTATGCATTGG - Intronic
1193258877 X:79381316-79381338 CAGCTTTAGCTCCTTTGCATTGG - Intergenic
1195265622 X:103176585-103176607 CAGCTTGAACATCCATGAACAGG + Intergenic