ID: 1086930973

View in Genome Browser
Species Human (GRCh38)
Location 11:92692662-92692684
Sequence CTGTCTGAAAGGATGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086930966_1086930973 27 Left 1086930966 11:92692612-92692634 CCAGGTAAGGAAAGGTCCGAGAG 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 211
1086930969_1086930973 11 Left 1086930969 11:92692628-92692650 CCGAGAGGGCTTCACATAGAAAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086930973 Original CRISPR CTGTCTGAAAGGATGGTGAA GGG Intronic
900495197 1:2973025-2973047 CTTTCTGGAAGGATGGTGGATGG - Intergenic
900896754 1:5488029-5488051 TTGGATGGAAGGATGGTGAATGG - Intergenic
900900521 1:5512902-5512924 CTGGCTGTAAGGATGGAGAAAGG + Intergenic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
901221105 1:7584313-7584335 CTGACTGAGAGGATGGCCAAGGG + Intronic
901354247 1:8629629-8629651 CTGTCAGAAAAGATGCTGACAGG - Intronic
903196163 1:21689888-21689910 CTGTGTGAAATGGTGGTTAAAGG - Intronic
903448023 1:23434767-23434789 ATGTCTGGGAGGAAGGTGAAGGG + Intronic
904350035 1:29899126-29899148 CTGTCTTAGAGGGTGGAGAAAGG + Intergenic
906108558 1:43308726-43308748 CTGGCTGGGAGGATGGTGAGGGG + Intronic
906842508 1:49155011-49155033 CTGTTTTAAAGAATGGTAAATGG - Intronic
907425299 1:54375663-54375685 CTGGTGGAAAGGATGGTGAGGGG + Intronic
909302397 1:74030011-74030033 CTCTTTGAAACGATTGTGAATGG - Intronic
911059652 1:93736894-93736916 CTTTCTGAAAGCATGGTCTACGG + Intronic
911912847 1:103656869-103656891 AGGTCTGAAAGGGTTGTGAATGG - Exonic
911915608 1:103695079-103695101 AGGTCTGAAAGGGTTGTGAATGG + Exonic
911920259 1:103751008-103751030 AGGTCTGAAAGGGTTGTGAATGG - Exonic
916721747 1:167489661-167489683 CTCTCAGAAAGGAGGCTGAAGGG + Intronic
918921761 1:190720959-190720981 CAGTATGGAAGGTTGGTGAAGGG - Intergenic
920736530 1:208537922-208537944 CTCTCAGAAAGGCTGGTGACAGG - Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063754523 10:8992036-8992058 CTTTCTGAAAGGAAAGGGAATGG - Intergenic
1066407482 10:35132265-35132287 GTGTTTGAAAGGATGGAGACAGG + Intronic
1067181175 10:43987087-43987109 CTGTTGGAGAGGATGGTCAAGGG - Intergenic
1067893299 10:50153666-50153688 CTTTGTGAAAAGATGGTGAGGGG + Intergenic
1068055226 10:52004999-52005021 ATAACTGAAAGGAAGGTGAAGGG - Intronic
1071296203 10:84221974-84221996 CTGTCTGTGATGACGGTGAAGGG - Exonic
1074150334 10:110753846-110753868 CTGTCTTTGAGGATGGAGAAGGG - Intronic
1074988349 10:118678420-118678442 CTTTCTGAATGGATTGTGAGGGG - Exonic
1075303865 10:121350061-121350083 CTGTCTGAAAAGTTTGAGAATGG + Intergenic
1078017381 11:7626603-7626625 ATAAGTGAAAGGATGGTGAATGG + Intronic
1078361271 11:10669739-10669761 GTGTCTGCAAGGAGGGTGAAGGG - Intronic
1078410144 11:11107977-11107999 ATGTCTAAATGGATAGTGAAAGG + Intergenic
1078466196 11:11552324-11552346 ATGTCTGAAAGAATGGGGTAGGG - Intronic
1081029002 11:38054139-38054161 CTGACTGAAGGGTAGGTGAAAGG - Intergenic
1083053531 11:59797954-59797976 CTGTCTCAAAGGATGTTGTAAGG - Intronic
1083926276 11:65808983-65809005 CTGTTTGAAAAGATTGTAAAAGG - Intergenic
1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG + Intronic
1087980175 11:104602842-104602864 CTGTCTGAAATGATGAGCAAAGG - Intergenic
1089356189 11:117855550-117855572 CTCTCTGGAAGGAGGGAGAAAGG - Intronic
1093999337 12:25677687-25677709 CTCTCTGAATGAATGCTGAAAGG + Intergenic
1097327065 12:58288996-58289018 TTGTATGAAAGGAGTGTGAAAGG + Intergenic
1097682210 12:62659441-62659463 CTGCCTGAGAGGATGGTGTGAGG + Intronic
1098071442 12:66679909-66679931 CTTTGTGAATGGATTGTGAAGGG - Intronic
1099123925 12:78728738-78728760 TTTTATCAAAGGATGGTGAAGGG + Intergenic
1099249380 12:80234429-80234451 ATGTTTTAAAGGATGGTGAAAGG + Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1103279106 12:119740093-119740115 CTGGCTGAAATGTGGGTGAAGGG + Intronic
1104378284 12:128284586-128284608 CTGTAAGAAATAATGGTGAAAGG + Intronic
1105606605 13:21931179-21931201 CAGTCTGAAAGGATGGTTTTTGG + Intergenic
1107349490 13:39499422-39499444 TTCTCTCAAGGGATGGTGAAGGG - Intronic
1110683363 13:78342756-78342778 GTGTCAGAATGGATGGAGAAGGG - Intergenic
1113394334 13:109932035-109932057 GGGACTGAAAGGATGGAGAAAGG + Intergenic
1114494209 14:23121404-23121426 CTGGCTGAAAGGATGGGAAGGGG + Intergenic
1121470054 14:94145882-94145904 CTGACTGAAAAGATGAGGAAGGG + Intergenic
1121589960 14:95096710-95096732 TTGTCTGAAACGAGGGGGAATGG + Exonic
1122098044 14:99385960-99385982 GTGTCTGAAAGGATTATAAAGGG + Intergenic
1125398245 15:39272714-39272736 CTGTCTGAGAAAATGATGAAAGG + Intergenic
1126510162 15:49462142-49462164 CAGTATGAGAGCATGGTGAAAGG + Intronic
1128191100 15:65698262-65698284 CTGTCTCAAAGAATGGAAAAAGG + Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1131051251 15:89349525-89349547 CTTTCAGAAAGGATGGTGGTGGG + Intergenic
1131683716 15:94750011-94750033 CTGTCTCTTAGGATGGGGAATGG + Intergenic
1133420286 16:5640274-5640296 CGGTCTGAAAGTACTGTGAATGG + Intergenic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133677391 16:8087758-8087780 GAGACTGAAAGGATGGTGGAGGG - Intergenic
1136452642 16:30362367-30362389 CTGTGTGAAATGCTGCTGAAGGG - Intronic
1137073731 16:35935148-35935170 CTGGCTGAAAGGTTAGTTAATGG + Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138358534 16:56405988-56406010 CTGTCAGAAGGGAAGGGGAAGGG + Intronic
1140527227 16:75632988-75633010 CTGGCTGAAAGGTTAGTTAATGG - Intronic
1141174323 16:81709341-81709363 CTGGCTCAAAGGATGGTGCTAGG - Intronic
1142394344 16:89823059-89823081 CTGTCTGTAAAGATGCTGAGAGG + Intronic
1146658823 17:34651292-34651314 CAGTCTTAAAGCATGATGAAGGG - Intergenic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1149317991 17:55456993-55457015 CTGTGTGAGAGGATTGCGAATGG + Intergenic
1152665492 17:81566470-81566492 CTGTCTGGACAGGTGGTGAAAGG - Intronic
1159373257 18:67557299-67557321 ATGCCTGAAAGTATGGTAAAAGG + Intergenic
1159550736 18:69894038-69894060 CTGGCTGAAAGCATGTGGAAGGG + Intronic
1159795460 18:72837886-72837908 CTGTCATAGAGGATGGTGATGGG - Intronic
1159915480 18:74183723-74183745 CTGTCTGGAGGGGTGGAGAATGG + Intergenic
1160677217 19:397856-397878 CTGTCTGGAAGGAAGGGGCATGG - Intergenic
1166517310 19:43457070-43457092 CTGTCTGGAAGGAGGTTGGAGGG + Intergenic
925732530 2:6929986-6930008 CTGGGTGAAAGGATGGCGTAAGG + Intronic
927153118 2:20206905-20206927 CTGTCTAGAAAGAGGGTGAAAGG + Intronic
927459734 2:23287575-23287597 CACTTTGAAAGGAGGGTGAAGGG + Intergenic
928080747 2:28310269-28310291 CAGGCTGAGAGGATGGTGAGTGG - Intronic
929716572 2:44316847-44316869 CTTTCTGAAAGAATAGTCAAGGG + Intronic
930934637 2:56933039-56933061 CTGTAAGCAAGGAGGGTGAAAGG - Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
932557079 2:72833931-72833953 TTGGATGAAAAGATGGTGAAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG + Intergenic
934202060 2:89894279-89894301 CTTTCTGAAGGGCAGGTGAAGGG - Intergenic
934865971 2:97811551-97811573 GTGCCTGAAAGGTTGGTGGAAGG - Intronic
935727488 2:106036602-106036624 GAGTTTGAAAGGATAGTGAAGGG - Intergenic
935740514 2:106143545-106143567 CTGTCAGATCGGATCGTGAATGG - Intronic
937073937 2:119087424-119087446 TCGTCTGAAAGGCTGGAGAAGGG + Intergenic
937701401 2:124866624-124866646 CTGTCTGAAAGCATGTTGTGTGG + Intronic
937796696 2:126031113-126031135 CGGTCTAAATGGATGGTGACAGG + Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938043527 2:128096109-128096131 CTGTCTGAGAGGATCTTGACAGG + Intronic
939141450 2:138359075-138359097 CTCTCTGAAAGGATGATTGAAGG - Intergenic
939249590 2:139666982-139667004 CCATCTGAAAGGAGGGGGAAGGG - Intergenic
940911670 2:159215097-159215119 CGTTCTGGAAGGATGGAGAAGGG + Intronic
943806010 2:192127093-192127115 CTGTCAGAAAGCCTGGTGGAGGG - Intronic
944890878 2:204116054-204116076 CTTTATGAAATGATGGTGACAGG + Intergenic
945634209 2:212326855-212326877 CTGTCTGTAAGGATAGAGAATGG + Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
946942976 2:224789509-224789531 CTCTCTCAAAGGATGTTGAAAGG + Intronic
947074272 2:226324996-226325018 CTGTCTGATATGACTGTGAAAGG + Intergenic
947758684 2:232587873-232587895 CTGACTGAAAGGGTGGAGGATGG - Intergenic
1172183968 20:33020070-33020092 CTCTCTGAAAGGATGGCGCCTGG + Intronic
1174121087 20:48266275-48266297 CTCTCTGAAAGGTTTGAGAAAGG - Intergenic
1174157579 20:48526205-48526227 CTATTTGAAAGTATGGTGCAGGG + Intergenic
1181119760 22:20657946-20657968 CTTTGTGAAAAGATGGTGAGGGG + Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
949282339 3:2360922-2360944 CTGTCTGAAAGAGTGGTGTGGGG + Intronic
950616808 3:14166449-14166471 CTGCCTGAGAGGATAGTGATGGG - Intronic
951195303 3:19816902-19816924 CTGGCTCACTGGATGGTGAAAGG + Intergenic
951594933 3:24308048-24308070 TTGTCAGAAAGGTTGGGGAAGGG + Intronic
952855524 3:37767361-37767383 CTGCCTTAAGGGATGGGGAAAGG + Intronic
953215865 3:40917507-40917529 CTGGGGGACAGGATGGTGAACGG - Intergenic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956896523 3:73666335-73666357 ATTTCTGAAAGGATAGTCAATGG - Intergenic
958727108 3:97919486-97919508 CTATCTCAAAACATGGTGAATGG + Intronic
958735701 3:98007231-98007253 CTGACTGAAATGAGGGAGAAGGG + Intronic
960122077 3:113957201-113957223 ATGTCAGAGAGGATGATGAAGGG - Intronic
962307238 3:134299729-134299751 CAGTCTGAAAGGAGACTGAAAGG - Intergenic
963777781 3:149457323-149457345 CTGTCAGAAATGACTGTGAAAGG + Intergenic
965387613 3:168063689-168063711 CTTTCTTAAAGGATGAAGAAAGG - Intronic
967954175 3:194864727-194864749 CTAAATGAAAGGATGGTGAAGGG + Intergenic
968967460 4:3776385-3776407 CTGGCTGGAAGGGTGGTCAAGGG - Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510521 4:7614940-7614962 ATGGGTGAATGGATGGTGAATGG - Intronic
969580007 4:8059191-8059213 CTGTCTGCAAGGAGAGTGATGGG + Intronic
969947714 4:10801504-10801526 CAGTCTAGAAGGATGGGGAAAGG - Intergenic
976294636 4:83457584-83457606 CTTTCTTAAAGTATGGTGCATGG - Intronic
976971941 4:91114556-91114578 CTGTCAGAAAGAATGATGAGAGG + Intronic
978207581 4:106096674-106096696 ATGACTGACAGGATGGTGGAGGG + Intronic
978351093 4:107821730-107821752 CTGTGTGGAAGGCTGTTGAATGG - Intergenic
981641363 4:146946984-146947006 CTGTGAGAAAGGAAGGTGCATGG - Intergenic
983121788 4:163895398-163895420 CTGGCTGAAAGGATGATGTTTGG + Intronic
984117662 4:175702448-175702470 CTGTCTGAAAAATTGGTTAATGG - Intronic
985331909 4:188846497-188846519 CTGTAAGAAAGGATGAGGAAGGG - Intergenic
989095142 5:37775087-37775109 CTGTTTGACAGGATAGTAAAGGG + Intergenic
989437900 5:41435865-41435887 CTATCTCAAATGATGCTGAATGG - Intronic
990374677 5:55157418-55157440 CTGTCTGAATGTTTGGTTAATGG + Intronic
991519387 5:67478876-67478898 TTGTCTGAAAGGAGGCTCAAAGG + Intergenic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
992317289 5:75569638-75569660 CTGCCTTAAAGTATGTTGAAAGG - Intronic
992480890 5:77151712-77151734 CTGTCTGGAAGGAGTGAGAAGGG - Intergenic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
993244664 5:85435825-85435847 CTGTTTGAAACAATTGTGAATGG - Intergenic
993834593 5:92802262-92802284 CTATCTGAAGGGCTGGTGCAAGG + Intergenic
994326666 5:98455761-98455783 TTGTCTGAAAATAAGGTGAAGGG + Intergenic
994674890 5:102808316-102808338 CTGACTGAAATCATAGTGAATGG + Intronic
996157350 5:120118362-120118384 CTGTTTGAAACAATTGTGAATGG - Intergenic
996601497 5:125269412-125269434 CTGCTTGAAAAGGTGGTGAATGG + Intergenic
998175384 5:139898671-139898693 CTTTGTGAAAGGATGGGAAAAGG - Intronic
998878108 5:146620558-146620580 CTCTCTGCAAGGTTGGTGAGTGG + Intronic
998921826 5:147077550-147077572 CTGGTTGAAAGGAAAGTGAAGGG - Intronic
998927299 5:147140780-147140802 CTGTCTCAAAGGTTAGTTAATGG - Intergenic
1001117161 5:168949288-168949310 CTGTCTGCAAAGACGCTGAACGG - Intronic
1004167958 6:13273494-13273516 CTGTCTGCAGCAATGGTGAAAGG - Intronic
1006731394 6:36238974-36238996 CTGATTGAGAGGATGGTGAGGGG + Intergenic
1011477524 6:87762640-87762662 ATGCCTGAAAAGATGGAGAAAGG - Intergenic
1012241561 6:96878850-96878872 ATGTCAGAGAGGATGGAGAAAGG - Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014291461 6:119563312-119563334 CTGTCTTTAAAGATGGTGCATGG - Intergenic
1014371572 6:120615654-120615676 CTGCCTGAAAGGATGATGTGAGG + Intergenic
1015948261 6:138524974-138524996 TTGGCTGAAAGGATCTTGAAAGG + Intronic
1016767386 6:147810341-147810363 CTTCCAGAAAGGCTGGTGAAAGG + Intergenic
1021854881 7:24844926-24844948 CTGTCTCAAAGAATTTTGAATGG - Intronic
1021989231 7:26126060-26126082 CTGTCCCGCAGGATGGTGAAAGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1022427029 7:30278754-30278776 CTGACTGAAGGGATGGGGATTGG - Intergenic
1022590275 7:31654772-31654794 TTGTATGAAAAGATGGTCAAAGG + Intronic
1026630188 7:72031316-72031338 CTCTCTGAAATGATGAAGAATGG - Intronic
1026824172 7:73570942-73570964 CTGTCTCCAAGGATGGTACATGG - Exonic
1026840035 7:73665390-73665412 CTGTCTAAAAAGAAAGTGAAGGG + Intergenic
1026919426 7:74144377-74144399 CTGTCTCAAAGAAAGGGGAAGGG - Intergenic
1028619672 7:92811348-92811370 CAGTGTACAAGGATGGTGAAGGG - Intronic
1030373209 7:108724152-108724174 CTGTCTGAAAGGAGGGGCAATGG - Intergenic
1031502653 7:122539301-122539323 CTGTATTAAAATATGGTGAAAGG - Intronic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1033040771 7:137915950-137915972 CTGTCTTGATGGATGTTGAAGGG + Exonic
1034609760 7:152355645-152355667 CTGTGTGAAATGATCCTGAAAGG + Intronic
1035082252 7:156226438-156226460 CTATCTGAAAGGATTGTCAGTGG + Intergenic
1035721303 8:1795439-1795461 ATGTATGAAAGAATGGTTAAAGG - Intergenic
1035897703 8:3422487-3422509 CTGTCTGAAAGCATTTTAAAAGG + Intronic
1037924958 8:22837149-22837171 GTGTCAGAAAGGATGGGGAAAGG - Intronic
1039088219 8:33800790-33800812 CTGTCTGTAAGGGCGGGGAAGGG - Intergenic
1041359453 8:57036674-57036696 CTGGCTCAAAGGTTGGTTAATGG + Intergenic
1041524154 8:58787223-58787245 CTGTCAGAAAGACTGTTGAAGGG - Intergenic
1044536157 8:93358450-93358472 CTGCCTCAAAGGATTGTAAAGGG - Intergenic
1045682195 8:104674249-104674271 CTATATGATAGGATTGTGAAAGG + Intronic
1047766039 8:127990846-127990868 GTGTCTGTGAGGATGGTGGAGGG + Intergenic
1048072290 8:131034570-131034592 CTGTTTGATAGGATGTTGAAAGG + Intronic
1048386038 8:133913365-133913387 ATCTCTGAGAGGCTGGTGAAGGG + Intergenic
1049233416 8:141495941-141495963 ATGACTGGATGGATGGTGAAAGG - Intergenic
1049972622 9:834689-834711 CTGTGTGATAGGATTATGAATGG - Intergenic
1052305150 9:27000131-27000153 CAGAGTGCAAGGATGGTGAATGG - Intronic
1052376135 9:27719551-27719573 CTGTGTGGAAGGAAGGTGATTGG + Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056721167 9:89073441-89073463 CTGTCTCACTGGATGGAGAAGGG + Intronic
1059031307 9:110700157-110700179 CTTTCTGAAAGGATGTCCAATGG + Intronic
1059556403 9:115284996-115285018 CTGTCTAAAATGATGCTGAGTGG + Intronic
1059704333 9:116806339-116806361 CTGTCTCAAAGGCTTGTCAAGGG - Intronic
1059806552 9:117807313-117807335 CTGGCTGAAAAGTTGGGGAAAGG - Intergenic
1060925470 9:127452346-127452368 CTGCCTGCAAGGATGGGGAATGG - Intronic
1060995379 9:127872706-127872728 CTGTCGGAAATCATGGAGAAGGG - Exonic
1061373431 9:130210642-130210664 GGGTCTGAAAGGAGGGTGTAAGG + Intronic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061741632 9:132710846-132710868 CTGTCAGAAGGGAAGGGGAAGGG - Intergenic
1186122224 X:6375525-6375547 CTGTCTGAAAGTATCAAGAATGG - Intergenic
1192263177 X:69520960-69520982 CTGTCTGAAAGTGTGGTTGATGG - Intronic
1194076638 X:89402173-89402195 CTGTATTAAAAGTTGGTGAAGGG - Intergenic
1194486286 X:94491065-94491087 CTCTTTGAAACAATGGTGAATGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1196886102 X:120246907-120246929 CTCTCTGAAAAGATGATGTATGG - Intergenic
1198676600 X:139137929-139137951 CTGTCTGCAAAGATGATGATTGG - Intronic
1200429280 Y:3057696-3057718 CTGTATTAAAAGTTGGTGAAGGG - Intergenic
1201551282 Y:15219422-15219444 CTGACTGAAAGCATCTTGAAGGG - Intergenic