ID: 1086931163

View in Genome Browser
Species Human (GRCh38)
Location 11:92694684-92694706
Sequence CCAGGGGAACAGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 400}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086931151_1086931163 13 Left 1086931151 11:92694648-92694670 CCCTGGGCAAGGAGCACCTGTGA 0: 1
1: 0
2: 3
3: 23
4: 246
Right 1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG 0: 1
1: 0
2: 2
3: 45
4: 400
1086931152_1086931163 12 Left 1086931152 11:92694649-92694671 CCTGGGCAAGGAGCACCTGTGAT 0: 1
1: 0
2: 2
3: 14
4: 157
Right 1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG 0: 1
1: 0
2: 2
3: 45
4: 400
1086931153_1086931163 -3 Left 1086931153 11:92694664-92694686 CCTGTGATGATAGAGAGTCCCCA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG 0: 1
1: 0
2: 2
3: 45
4: 400
1086931150_1086931163 21 Left 1086931150 11:92694640-92694662 CCATGTGACCCTGGGCAAGGAGC 0: 1
1: 0
2: 12
3: 81
4: 528
Right 1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG 0: 1
1: 0
2: 2
3: 45
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086931163 Original CRISPR CCAGGGGAACAGAGGGCAAA GGG Intronic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
900864828 1:5260780-5260802 CCAAGGAGACAGGGGGCAAATGG - Intergenic
901817727 1:11804506-11804528 ACAGGCCAACAGAGGGCATAGGG + Intronic
901921062 1:12538079-12538101 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
902673698 1:17993703-17993725 CCAGGAGAAAAGAGAGAAAATGG + Intergenic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
905224729 1:36471779-36471801 ACAAGGGAACAGAGGGAAAAGGG - Intronic
905302543 1:36995676-36995698 CCAGGGGAAGATAAGGCAACAGG - Intronic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
906844896 1:49181232-49181254 CCATGGGAACAGAGTGTACAAGG - Intronic
907918143 1:58889362-58889384 TCTGGGGAACAGAGGGTATAGGG - Intergenic
908112275 1:60909229-60909251 CCTAGGGCACAGAGTGCAAAAGG + Intronic
909599493 1:77447058-77447080 GAAGAGGAACAGAGGTCAAAAGG + Intronic
910117686 1:83750656-83750678 ACAGGGAAACATAGGCCAAAAGG + Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910717040 1:90243571-90243593 CCAAAGGACCAAAGGGCAAAAGG + Intergenic
911282148 1:95942885-95942907 CCAGGCGAAGTGATGGCAAATGG - Intergenic
911856907 1:102889507-102889529 CCAGGAGAACAAGGGGAAAAAGG - Exonic
912151677 1:106866726-106866748 GCAGAGAAACAGAGGGAAAATGG - Intergenic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913121568 1:115745983-115746005 CCAGGGTAAAAGAGGGGATAGGG - Intronic
915160119 1:153913317-153913339 CCTGGGGATCAGAGGAGAAAAGG - Intronic
915371291 1:155352936-155352958 TCAGGGGAAAATAGAGCAAATGG - Intronic
915520248 1:156437614-156437636 CCAGGAGAACAGGGAGCAAGAGG + Intergenic
917580979 1:176377550-176377572 ACAGGGTAACAGAGGGAAAAAGG - Intergenic
917789821 1:178492387-178492409 TCAGGGGAACAGAGGGGACGCGG + Intergenic
917795432 1:178529538-178529560 CCAGAGGGCCACAGGGCAAAGGG - Intronic
919155146 1:193754725-193754747 TCAGAGGATCAGAGGGAAAAAGG + Intergenic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920586394 1:207166974-207166996 ACAGGGAAACAGAAGGAAAAGGG - Intergenic
920754022 1:208710215-208710237 CCAGCCAAACAGAGGGCACAAGG - Intergenic
921377403 1:214488726-214488748 TCAGGATCACAGAGGGCAAATGG + Intronic
923558069 1:235017346-235017368 CCAGGAGAACAGATGGAAAGAGG + Intergenic
923978203 1:239288745-239288767 CCAGGGCAAGAGAGGGAAAAGGG + Intergenic
1063051685 10:2456407-2456429 GCAGGTGAACAGAGAGTAAAAGG + Intergenic
1063956235 10:11270249-11270271 ACAGGTGGACAGAGGACAAAGGG - Intronic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1065038878 10:21670582-21670604 CTAGAGGGTCAGAGGGCAAAGGG + Exonic
1069713535 10:70506388-70506410 CCAGGGGTCCAGAGGTCAACAGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069792487 10:71031890-71031912 ACAGAGGAAGAGAAGGCAAAAGG - Intergenic
1069836453 10:71311498-71311520 CCTGGTGAAAATAGGGCAAAGGG + Intergenic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070129139 10:73644742-73644764 ACCTGGGAACAAAGGGCAAAAGG + Intergenic
1070382906 10:75897603-75897625 CCAGGGAAACTGAGGCTAAAGGG + Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071964846 10:90842216-90842238 CAAAAAGAACAGAGGGCAAAAGG - Intronic
1072007461 10:91267168-91267190 CCAGGGGAGGTGAGGGCAAGTGG - Intronic
1072751766 10:97985896-97985918 CCAGGGACACTGAGGTCAAATGG - Intronic
1073045830 10:100637754-100637776 CCAGGGGAAAAGTGGGGAGAAGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073943222 10:108721416-108721438 CCAGCAGGAGAGAGGGCAAAAGG + Intergenic
1076178097 10:128384256-128384278 CCTGGGGAATAGAAGTCAAAGGG + Intergenic
1076599535 10:131647929-131647951 GCAGGGGGACAGAGAGCAACAGG - Intergenic
1078053890 11:7991321-7991343 CCATGGGACCAGATGGCTAAAGG + Intronic
1078416452 11:11170143-11170165 CCAGGGGAAGAGTGGGCCCAGGG + Intergenic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079100084 11:17535679-17535701 CCATGGGAACAGAAGGGGAAGGG + Intronic
1079724404 11:23862896-23862918 CCATGGAAACAGAGGAGAAAAGG - Intergenic
1080441829 11:32301624-32301646 CCAGGGGAATGGAGGGGCAAGGG + Intergenic
1080642805 11:34167539-34167561 CCTGGGCAAAAGAGGGCAGATGG + Intronic
1081656917 11:44863441-44863463 CCAGGGAAGAAGAGGACAAAAGG - Intronic
1082952383 11:58831042-58831064 CCAGGGGAGCAGGGGACAAGCGG + Intergenic
1083658774 11:64242452-64242474 CCACGGGGGCCGAGGGCAAAAGG + Exonic
1083853206 11:65379607-65379629 CCAGGGGTGGAGAGGACAAAGGG - Intronic
1084215793 11:67646216-67646238 CCAGGGGAAGAGAGGTGAGAGGG - Intronic
1084870078 11:72092644-72092666 CAAGGGGGACAGAGAGGAAAAGG - Intronic
1085445546 11:76598419-76598441 CCAGGGGCACAGAGGAGCAAAGG - Intergenic
1085518747 11:77126162-77126184 CCAGGGGGACAGAGGGACACAGG - Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087052056 11:93896233-93896255 GGAGGGAAACAGAGGACAAATGG - Intergenic
1088627258 11:111738194-111738216 CCAGGAGAACACTGGGCAACAGG + Intronic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1088738670 11:112749140-112749162 GCAGGGGAACTGGGGGCCAAGGG - Intergenic
1089139239 11:116273078-116273100 CCAGGGGCACAGGGAGCAAAGGG + Intergenic
1090349556 11:126098843-126098865 CCAGGGGAACCCAGGCCACATGG - Intergenic
1090826317 11:130389151-130389173 CAAAGGGAAGAGAGGGGAAATGG - Intergenic
1091239102 11:134040568-134040590 CGTGGGGAACAGAGGGCAAGGGG + Intergenic
1092088489 12:5785210-5785232 ACAGGGGATGAGAGGGAAAAGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092126900 12:6080905-6080927 CCACAGGAAAAGAGGGCACACGG - Intronic
1092435057 12:8440974-8440996 CCAGGGGAAGAGAGGATAATTGG + Intergenic
1092949549 12:13488539-13488561 CCAGGGAAACAAAAGGAAAAGGG + Intergenic
1093297580 12:17410284-17410306 CAAGAGGAACAGAAGGCAATAGG + Intergenic
1094711965 12:32973514-32973536 CCAGGAGATCAAAGGGGAAATGG - Intergenic
1095319187 12:40805255-40805277 CCAGAAGAAAAGAGGGAAAAGGG - Intronic
1096203736 12:49705282-49705304 CCAGGAGAACCCAGGTCAAATGG - Intronic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1097477938 12:60082552-60082574 TCAGGAGAACAGAGGGAGAAAGG - Intergenic
1097819229 12:64110928-64110950 CCAGGTGAACATATGACAAATGG - Intronic
1101560972 12:105857709-105857731 CCACGGGCACAGAGGGCACCAGG + Intergenic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103345915 12:120250143-120250165 CCAGGAGTACACAGGGGAAATGG + Intronic
1103722795 12:122983603-122983625 CCAGAGAAACAGACGGCACACGG + Exonic
1104521607 12:129480862-129480884 ACAGAGGACCAGAGGGCACATGG + Intronic
1104610604 12:130224782-130224804 CCAGGGAAAGAGCGGGGAAATGG + Intergenic
1104798589 12:131537271-131537293 TCTAGGGAACAGAGGGGAAATGG + Intergenic
1105284979 13:18996204-18996226 GCAGAGGGCCAGAGGGCAAAAGG + Intergenic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1106076393 13:26464786-26464808 GCAGGGGAACAGAGCGGAGAAGG + Intergenic
1106084810 13:26531888-26531910 CGAAGGGAACAGAGGGCCATTGG + Intergenic
1106618219 13:31350094-31350116 TCAGAGGAAGAGGGGGCAAAGGG - Intergenic
1107432709 13:40354406-40354428 CCAGGGAAGTAGAGGACAAAAGG - Intergenic
1108454200 13:50596864-50596886 CCAGAGGGATAGAGGGGAAAGGG + Intronic
1108517753 13:51218944-51218966 TAAGGGGACCAGATGGCAAAGGG - Intergenic
1110972057 13:81776204-81776226 CCAGGGGTTCAGAGGGAGAAAGG - Intergenic
1111370543 13:87311235-87311257 CCTGGGGAACAGGGGCCAAGTGG + Intergenic
1111652660 13:91111666-91111688 CCAGGCAAACAGAGCGGAAAAGG + Intergenic
1112149713 13:96744898-96744920 CCAAAGGAACAAAGGGAAAATGG + Intronic
1112297639 13:98202289-98202311 CCAGGAGAGCAAAGAGCAAAGGG - Intronic
1113308728 13:109108669-109108691 CCAGGTGCAAAGAGAGCAAATGG + Intronic
1113402599 13:110007515-110007537 CTAGGGGAAGAGAGTGCAATGGG + Intergenic
1114522322 14:23347283-23347305 CCATGGGAACAGAGAGCCAAGGG - Intronic
1115709881 14:36039278-36039300 ACAGGGGAAAAGTGGGGAAAGGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117289739 14:54320861-54320883 GCAGGAGACCAGAGGGCAAGAGG + Intergenic
1117737009 14:58777728-58777750 CCATGGGGTCAGAGGGCAAGGGG + Intergenic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1118855194 14:69615551-69615573 CCAGAGGATGAGAGAGCAAATGG - Intronic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1119668898 14:76504009-76504031 CCTGGGGAACAAGGGGCACAAGG + Intergenic
1124091385 15:26605984-26606006 CATGGGGAAGAGAGAGCAAATGG + Intronic
1124422116 15:29531514-29531536 CCATGGGGACGGAAGGCAAAAGG + Intronic
1124635579 15:31362714-31362736 CCAGGGGAACACTGAGCAGATGG - Intronic
1125731556 15:41895140-41895162 CCAGGGGCAGTGAGGGCAGAAGG - Intergenic
1125972507 15:43923341-43923363 ACAGGGTAGCAGAGGGCACATGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1128091479 15:64922041-64922063 CCAGGGGAGCCGAGGGGACAGGG - Intronic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128369028 15:67025850-67025872 CCAGGGAGAGAGAGGGCAAGCGG + Intergenic
1129177101 15:73848016-73848038 CCTGGGGGAAAGAGGGGAAAGGG + Intergenic
1129879801 15:78999114-78999136 CCCAGGGAACAGAGCTCAAAGGG + Intronic
1130106796 15:80934807-80934829 CCAGAGGAAGACAGGGCAGAGGG + Intronic
1130199317 15:81810462-81810484 AGATGGGAACAGAGGACAAAAGG - Intergenic
1130325836 15:82879183-82879205 TCAAGGAAACAGAGGGAAAATGG - Intronic
1131020402 15:89093102-89093124 TCTGGAGAACAGAGAGCAAACGG - Intronic
1131098694 15:89671702-89671724 CAAGGGCGAAAGAGGGCAAAGGG - Intronic
1131382180 15:91973151-91973173 GCAGGGGAACTGAGGCAAAAGGG + Intronic
1131670240 15:94612030-94612052 CCAGGGTAACAAACGGCAAATGG - Intergenic
1132301048 15:100775763-100775785 GGAGGGGGACAGTGGGCAAAGGG - Intergenic
1132316962 15:100897421-100897443 CCAGGGGTACAGTGGGCAATGGG + Intronic
1132387116 15:101408474-101408496 CCAGGGAGACACAGGGCAGAAGG + Intronic
1133807951 16:9139359-9139381 TCCGGGGAAAGGAGGGCAAAGGG - Intergenic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1135573017 16:23563743-23563765 ACAGGGGACCACAGGGCAAACGG - Intronic
1135574353 16:23573819-23573841 CCAGGGGCAGAGAAGGGAAAGGG + Exonic
1136169921 16:28482675-28482697 GCAGGGGAACAGAGAGAGAAGGG + Intronic
1137527998 16:49253716-49253738 CCAGGGAAACTGTGGGTAAACGG + Intergenic
1137587077 16:49670051-49670073 CCACGAGAACAGAGGAAAAAAGG + Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1137810842 16:51351044-51351066 CAAGAGGAAGAGAGAGCAAAGGG + Intergenic
1138317681 16:56084253-56084275 TATGGGGACCAGAGGGCAAAAGG + Intergenic
1138599328 16:58045732-58045754 CCAGGGGAGCAGAGGGGCAGAGG + Exonic
1139667455 16:68467697-68467719 CCAGGGGAACAGATTTCTAATGG + Intergenic
1140123863 16:72104736-72104758 CCTGGGGACCATGGGGCAAATGG + Intronic
1142359538 16:89619684-89619706 GGAGGGGAGCAGGGGGCAAAAGG - Intronic
1143473990 17:7192658-7192680 CCATGGGAAGAGAGGAGAAATGG + Intronic
1143622897 17:8091200-8091222 CCCTGGGGACACAGGGCAAAGGG - Intergenic
1143875877 17:9990381-9990403 CCAGGGGAAAGCAAGGCAAAGGG + Intronic
1143891896 17:10108278-10108300 CCAGTGGAACACAGGCCATATGG - Intronic
1144583160 17:16471443-16471465 CCAGGGGCACACCAGGCAAAAGG + Intronic
1144631134 17:16873124-16873146 AGAGGGGCACAGAGGGTAAAGGG - Intergenic
1144650155 17:17002213-17002235 AGAGGGGCACAGAGGGTAAAGGG + Intergenic
1145242474 17:21248018-21248040 AAAGGGGAACAGAGGGCATCTGG + Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1147387426 17:40090609-40090631 ACAGGGAAACAGAGTGCTAAAGG - Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147965800 17:44193626-44193648 CCATGGGGACTGAGGGGAAAGGG + Exonic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1148134753 17:45284986-45285008 CCAGGGCAGCAGAGGGCTACAGG + Intronic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150905826 17:69336123-69336145 CCATGGGAAAAAAGGGAAAATGG - Intergenic
1151246172 17:72796562-72796584 AAAGGAGAACAGAGGGGAAAGGG + Intronic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151995947 17:77609350-77609372 CGAGGGAAAAACAGGGCAAAAGG + Intergenic
1152336076 17:79700844-79700866 CCAGGGGAGCACAGAGCAAGAGG + Intergenic
1152821669 17:82440827-82440849 CAAGGGGACCTGGGGGCAAATGG - Intronic
1156538694 18:37888711-37888733 TCAGAGGACAAGAGGGCAAAGGG + Intergenic
1157291632 18:46413633-46413655 CCCTGGGAACCCAGGGCAAAGGG + Intronic
1158150828 18:54367795-54367817 CAAGGAGAAGAGAAGGCAAAAGG - Intronic
1160223081 18:76991388-76991410 GCAGGGGAACACAGGGGACATGG + Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1161984843 19:7647476-7647498 CCAGGGCCACCGAGGGCAAGTGG + Exonic
1162398514 19:10431481-10431503 ACCGGGCCACAGAGGGCAAATGG + Intronic
1163024621 19:14503351-14503373 GCAGGGGAAGACAGGGTAAATGG - Intergenic
1163819325 19:19487210-19487232 CCAGATGAACAAAGGGCAAGGGG - Intronic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165146604 19:33734917-33734939 CAAGCTGAACAGAGGGTAAACGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167306607 19:48713527-48713549 CCAGGGGAATAGGGGGCAGGGGG + Exonic
1167836053 19:52070944-52070966 CCAGGAGGACAAAGGGCAAGAGG + Intronic
1168210039 19:54883656-54883678 CCAGGGGAACACAGAGCTACTGG + Intronic
925451485 2:3973235-3973257 CCAGGGGAAGAGAAGGCACCCGG + Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
926785860 2:16517915-16517937 GCAGGGGAAAAGAAGGAAAATGG - Intergenic
927212141 2:20645509-20645531 CCAGGGGAAAAGAAGGCAGGTGG + Intronic
927303657 2:21544883-21544905 CCTGGGCAACAAAGGACAAAAGG - Intergenic
927394869 2:22638197-22638219 CCTGGAGACCAGAGGCCAAAGGG - Intergenic
927841053 2:26444487-26444509 CCAGGGGAACACACCACAAAAGG - Intronic
927934056 2:27065313-27065335 CCAGGGGGACAGATGGTAAATGG - Intronic
928551692 2:32378161-32378183 ACAGGGAAAGAGAGGGCAAGAGG + Intronic
928846264 2:35676863-35676885 CTTGGGGGAAAGAGGGCAAAGGG - Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
930406727 2:50967649-50967671 AAATGGGAAGAGAGGGCAAAAGG + Intronic
931461399 2:62453309-62453331 CCAGGGGAGCAGGAGGCACACGG + Intergenic
931845858 2:66203290-66203312 CCAGGGAAACAGGGGCCAGAGGG + Intergenic
933835811 2:86244704-86244726 CCAGAGCAACTGTGGGCAAAGGG + Intronic
934547602 2:95231667-95231689 CCAGGGGAACATTTGGCAAAAGG + Intronic
934767556 2:96888430-96888452 TCAGGGGGACAGAGGGTAAGTGG + Intronic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
938398094 2:130965182-130965204 CCAGAGGAGCAGAGGGCCATAGG + Intronic
938576059 2:132605808-132605830 GCAGGGTAGCAGAGGCCAAAGGG + Intronic
938984088 2:136556226-136556248 CCAGGGGCAAGGAGGGCAAAGGG + Intergenic
940315400 2:152322698-152322720 AGAGGGCAACAGAGAGCAAAAGG - Intergenic
941773419 2:169366129-169366151 ACAGGGAAGCAGAGGGCAAGGGG + Intergenic
942672340 2:178389705-178389727 CCAGAGAAACTGAGGGAAAATGG - Intronic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
945250467 2:207761649-207761671 CCATTGGAAAAGGGGGCAAAGGG - Intronic
945264711 2:207879600-207879622 GCAGGAACACAGAGGGCAAATGG + Intronic
945987388 2:216365887-216365909 CCAGCAGAACAGCAGGCAAAAGG + Intronic
946385606 2:219382620-219382642 GGAAGGGAAGAGAGGGCAAAGGG - Intronic
946883163 2:224196188-224196210 CCAGGGGGTCAAAGGTCAAAAGG + Intergenic
947735456 2:232452252-232452274 GCAGGGGAGCAGGGGGCAAGAGG - Intergenic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948068911 2:235104046-235104068 CAAGAGGAAGAGAGAGCAAAGGG + Intergenic
948659881 2:239500497-239500519 TCAGGGCAACAGAGGGCAGGAGG + Intergenic
948817435 2:240519663-240519685 CCAGGGGGACAGGTGGGAAAAGG + Intronic
949032819 2:241805013-241805035 CCAGGGGCTCAGCGGGTAAAGGG + Intergenic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1168806773 20:676309-676331 CGAGGGGAACGGAGGGAAAGCGG + Intergenic
1168940546 20:1707602-1707624 TGGGGGGAACACAGGGCAAAGGG + Intergenic
1170122354 20:12924868-12924890 CCAGGGTCACAGTGAGCAAATGG - Intergenic
1170372999 20:15669809-15669831 CCAGGGGCACAAAGGGCAGGTGG + Intronic
1171306528 20:24112049-24112071 CCAGTGGCACACAGGGCACATGG + Intergenic
1172767729 20:37359626-37359648 CCAGGGGAACAGAGTGAGAAAGG + Intronic
1172785223 20:37464298-37464320 CCAGGGGAACAAGGGGGGAATGG - Intergenic
1172810696 20:37645864-37645886 CCAGAGGAACAGAACCCAAAAGG - Intergenic
1172855726 20:38000713-38000735 TCAGGGGAGCAGAGTGGAAATGG + Intronic
1172946788 20:38695576-38695598 TCAGGGGCACAGAGGGTAAGGGG + Intergenic
1173245668 20:41335797-41335819 GCAGAGGAACAGAGGACAACAGG - Intergenic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1174487438 20:50870328-50870350 ACAGGGCAGCACAGGGCAAACGG + Intronic
1174532996 20:51229591-51229613 GCTGACGAACAGAGGGCAAAGGG + Intergenic
1174684349 20:52439169-52439191 CAAAGGGAACAGAAGGCAAAAGG - Intergenic
1175689815 20:61057182-61057204 CCAGGGGAAGAGATGGCTAAAGG + Intergenic
1175785569 20:61709661-61709683 CCAGAGTAAAGGAGGGCAAATGG + Intronic
1176075093 20:63244735-63244757 CCAGGGCCACTGAGGGAAAAAGG + Intronic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1177170294 21:17647814-17647836 CCAAGGGAGAAGAGGGCCAAGGG - Intergenic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1178824781 21:36005793-36005815 CCAGGGGTAAAGTGGGAAAATGG + Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1180178475 21:46104581-46104603 CCAGAAGAAGAGAGAGCAAAGGG + Intronic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181848910 22:25735783-25735805 TCAGGATAACAGAGGGCAAGAGG + Intergenic
1182087493 22:27571401-27571423 TCAAGGGAACAGAGGCCACAGGG + Intergenic
1182614545 22:31578212-31578234 CCAGGGAAGCAGTGGGCAAAGGG - Intronic
1182628046 22:31662659-31662681 CCAGGGAGACCGGGGGCAAACGG + Intergenic
1182995499 22:34808373-34808395 CGAGGGGAAGAGACAGCAAAGGG - Intergenic
1183171635 22:36192797-36192819 CCAGAGGAACTGAGGACTAAAGG + Intronic
1183688697 22:39376234-39376256 CCAGGGGCTCAGTGGGGAAAGGG - Intronic
1183927479 22:41216535-41216557 CCAGGGAAACAGAAACCAAAAGG - Intronic
1184560566 22:45260696-45260718 CCAGGGGAAGTGAGGGCTACAGG + Intergenic
1184887579 22:47355806-47355828 ACAGAGGTACAGAGGGCACAGGG - Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
949516773 3:4814575-4814597 CGAGGGGAAGGAAGGGCAAAGGG + Intronic
950883721 3:16344928-16344950 ACAGATGAAGAGAGGGCAAATGG - Intronic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
951911497 3:27755062-27755084 CGAGGGGAACAGAGGGCCAGTGG + Intergenic
952261505 3:31744728-31744750 CCAGGGGAACAAAGCTCAAATGG - Intronic
952261617 3:31745877-31745899 TCAGTGAAACAAAGGGCAAAGGG + Intronic
953617284 3:44502725-44502747 TCAAGGGTACAGAGGGCACAGGG + Intronic
954390847 3:50267339-50267361 CCAGGGGCTCAGCAGGCAAAGGG - Intergenic
954530051 3:51310435-51310457 CCATGGGAACAGAGAGGAGAGGG + Intronic
954780587 3:53056566-53056588 CCAGGAGAAGAGAGGATAAAGGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
961025310 3:123550547-123550569 ACAGAGAAGCAGAGGGCAAATGG + Intronic
961707782 3:128802410-128802432 GCACAGGAACAGAGGGCACAGGG + Intronic
961904094 3:130244455-130244477 CAAGGAGAAAAGGGGGCAAAGGG + Intergenic
963259395 3:143177512-143177534 CCACGGGAAATGAGGGCAAATGG + Intergenic
964002326 3:151789954-151789976 CCAGGGAAAAAGATGGTAAAGGG - Intergenic
964082992 3:152783263-152783285 CCAGGAGGAGAGAGAGCAAAGGG + Intergenic
964439056 3:156685904-156685926 CAAGGTGTAGAGAGGGCAAATGG + Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966871497 3:184292795-184292817 CCAGGGAAACAGTGGGCAGCAGG - Exonic
967113870 3:186319207-186319229 ACAGGGGACCATAGGGCTAATGG - Intronic
967451257 3:189625924-189625946 GCAAGGGAACAGAGGCCAATTGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968640077 4:1709974-1709996 CCAGGGGACCAGTTGGAAAATGG - Intronic
968684608 4:1949067-1949089 CCAGGGGAGCACAGGGCATGGGG - Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
969633197 4:8350524-8350546 TCAGGGGAACAGAGGGGAGCCGG + Intergenic
970575520 4:17423208-17423230 CAGGAGGAACAGAGAGCAAAGGG + Intergenic
971137772 4:23888638-23888660 CCAAGGCAAGGGAGGGCAAATGG + Intronic
971455519 4:26840539-26840561 CCAGGGGAACAGCAGAAAAATGG - Intergenic
974520829 4:62977911-62977933 GAAGGGAAACAGAGGTCAAAGGG - Intergenic
975647422 4:76558942-76558964 CCTGGGGCCCAGAGGGGAAAGGG - Intronic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
975714078 4:77188997-77189019 CCAGGGGAACAGGTGGTGAAAGG - Intronic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
977492411 4:97731884-97731906 CAAAGGGACCAGAGGACAAAGGG - Intronic
977564281 4:98566050-98566072 CCAGGGGAAATGAGAGGAAAGGG + Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
977769958 4:100846518-100846540 CCAGGGTGACAGAGTGCAAGTGG - Intronic
981275084 4:142889982-142890004 ACAGGGAAACAAATGGCAAAAGG + Intergenic
981913086 4:150004756-150004778 TCAGGGGAATACAGGTCAAAAGG + Intergenic
983982853 4:174020339-174020361 CCAGAAGAAAAGTGGGCAAATGG - Intergenic
984188254 4:176572925-176572947 CCAGGGGGACAAAATGCAAATGG - Intergenic
984901488 4:184590579-184590601 CCAGAGGAACACGGGGCACAGGG - Intergenic
985028386 4:185762567-185762589 CCAGTGTCACAGAAGGCAAAGGG + Intronic
985095930 4:186413338-186413360 ACTGGGGAAGAGACGGCAAATGG + Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985730315 5:1543852-1543874 CAAAGGGAAGGGAGGGCAAAGGG - Intergenic
987038524 5:14040655-14040677 CCCAGGGAACAGAGGGCACTTGG + Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
988137607 5:27194238-27194260 TCTGGGGAACAGAAAGCAAAAGG + Intergenic
988987046 5:36630528-36630550 ACAGGGGAACAGTGAGCCAAGGG - Intronic
989111728 5:37913304-37913326 CCATGGGAACAAAGGGGAAGGGG + Intergenic
989349040 5:40463570-40463592 GCAGGGGATCACAGGGCAATGGG - Intergenic
989391476 5:40905209-40905231 CCAAGGGAGGTGAGGGCAAATGG + Intergenic
991202782 5:64013626-64013648 CCAGGGGAACAGAGTGCTCAAGG - Intergenic
991705376 5:69353234-69353256 GCTGGGGAACTGAGGGTAAATGG + Intronic
992728346 5:79632103-79632125 CCAGAGAAACAGAGTGCAGAAGG + Intronic
993407683 5:87531838-87531860 CCAGGAGTTCAGAGGGAAAAAGG - Intergenic
994851936 5:105066852-105066874 CAAGTGAAAAAGAGGGCAAAGGG + Intergenic
995659381 5:114463976-114463998 CCAGGAGTACACAGAGCAAAAGG + Intronic
995835123 5:116392975-116392997 CCAGGAGCTCAAAGGGCAAAGGG - Intronic
996606736 5:125331483-125331505 CTAGGGGAGCAGAGAGCAAAAGG + Intergenic
996799770 5:127390169-127390191 TCTGGGGAAAAGAGGGAAAAGGG - Intronic
997114633 5:131112774-131112796 CCACTGGAACAGAAGGAAAAAGG + Intergenic
997515958 5:134490130-134490152 CAAGGGCCACAGAGGGAAAACGG - Intergenic
997975766 5:138440513-138440535 CCTAGGGAACAGAGGGCACAGGG - Intronic
998540272 5:142974824-142974846 CCTGAGGGACAGAGGGCGAAAGG - Intronic
998600878 5:143583746-143583768 ACAGGGGAACATAGGGAAAGAGG - Intergenic
1000630756 5:163587878-163587900 CCAGGGAAGCAGATGGCAGAAGG - Intergenic
1001137248 5:169112744-169112766 GCAGGAGATCAGAGGGCAAGAGG + Intronic
1001816446 5:174673219-174673241 GGAGGGGGGCAGAGGGCAAATGG - Intergenic
1002636216 5:180610095-180610117 CCAGGAGAAGAGGGGGCACAGGG - Intronic
1003372143 6:5538928-5538950 CATGGGGAACAGAGAGCAACTGG - Intronic
1003712285 6:8605416-8605438 ACAGGGCATCAGAGGGCAGAGGG - Intergenic
1005402546 6:25449439-25449461 CCAGGGGAAGAGGTAGCAAAAGG + Intronic
1005848503 6:29801248-29801270 TCAGGGGATCTGAGGGCAAGAGG - Intergenic
1007127643 6:39440846-39440868 CCAGGGGCATAGAGAGGAAATGG + Intronic
1007249006 6:40482962-40482984 CCAAGGGAACAGAGGGACAGTGG - Intronic
1007572924 6:42906194-42906216 CCAGGGCACCAGAGGCCAAGAGG + Intergenic
1007837382 6:44684154-44684176 GAAGGGGAACAGACGCCAAAGGG + Intergenic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1011747343 6:90419059-90419081 CCAGAGGAGCAAAGGCCAAATGG - Intergenic
1012040186 6:94194247-94194269 CCAGGGGTCATGAGGGCAAATGG + Intergenic
1013478070 6:110528049-110528071 CCAGGGGAGCAGCTGTCAAAAGG - Intergenic
1014999061 6:128191957-128191979 CCAGGGAAACACAGGGAAATGGG + Intronic
1015886447 6:137923201-137923223 CAATGGGAACAGAGAGGAAAAGG - Intergenic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1016515781 6:144891896-144891918 AGGGGGAAACAGAGGGCAAAGGG + Intergenic
1016605490 6:145918616-145918638 CCAGGGGGACAGAGGAAAGAAGG - Intronic
1017367358 6:153659757-153659779 CAAGAGCAACAGGGGGCAAAAGG - Intergenic
1017418667 6:154249493-154249515 CCAGGGGAATAGGGAGAAAAGGG + Intronic
1017423320 6:154295547-154295569 CTTGGGGAACAGAGAGCACAGGG + Intronic
1017975848 6:159356684-159356706 GCAGTGGGTCAGAGGGCAAAGGG - Intergenic
1018775877 6:167015358-167015380 GCAGGGGAACAAAGAGCTAAGGG - Intronic
1018889801 6:167975639-167975661 CCAGGAGAACAGTGGCGAAAAGG - Intergenic
1019476041 7:1244811-1244833 CCAGGGTAATAGAGTGCTAATGG - Intergenic
1019660172 7:2219697-2219719 GCAGGGGAGCAGAGGGCCAGGGG + Intronic
1021804763 7:24343771-24343793 CCAGGAGGACAGAGAGCATATGG + Intergenic
1022040676 7:26578601-26578623 ACAAGGGATCTGAGGGCAAACGG + Intergenic
1022803284 7:33796038-33796060 CCAGCGGAAAGGAAGGCAAATGG - Intergenic
1024996104 7:55274165-55274187 TCAGGGGAAGGGAGAGCAAATGG - Intergenic
1026180591 7:68036010-68036032 CCAAGGCATCAGAGGGCAAGTGG - Intergenic
1026847298 7:73705331-73705353 CCAGGGGAACAGGGGAGAACAGG - Intronic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1028433275 7:90772580-90772602 CAAGAGGAAGAGAGAGCAAAGGG - Intronic
1028450633 7:90978099-90978121 CCAGGTACAGAGAGGGCAAAGGG + Intronic
1028745231 7:94320024-94320046 CCAAGGGAATACAGGGCCAATGG + Intergenic
1029276614 7:99408816-99408838 CCACCGGAAGTGAGGGCAAATGG + Exonic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032691068 7:134287197-134287219 GCAGGGACACACAGGGCAAAGGG + Intergenic
1033991113 7:147288031-147288053 CAAAGGGACCAGAGTGCAAAAGG - Intronic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034489830 7:151387278-151387300 CCAGGGCAGGAGAGGACAAAGGG + Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034741010 7:153473336-153473358 CCAGGGGAACAGAAAGCAACAGG - Intergenic
1035013654 7:155743875-155743897 CCAGGGGGATAGTGGGCACAAGG - Intronic
1035088160 7:156279130-156279152 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
1035201318 7:157268634-157268656 CCAGGGGAAAGGAGGGCGAGCGG - Exonic
1035702415 8:1646795-1646817 GAAGGGGGCCAGAGGGCAAACGG + Intronic
1037484119 8:19331406-19331428 CCAGGGCAACTGTGGGCCAAAGG - Intronic
1038179779 8:25215284-25215306 CCATGGGAACAGAGGGCCTTTGG + Intronic
1038723716 8:30060621-30060643 CCAGGGTAGCAGGGGCCAAATGG - Intergenic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039438957 8:37581431-37581453 CCAGGGGAGCACAGGACACATGG - Intergenic
1042213260 8:66402893-66402915 CCAGGAGGGGAGAGGGCAAATGG + Intergenic
1042855341 8:73261390-73261412 ACACGGGGAGAGAGGGCAAACGG + Intergenic
1044334541 8:90963861-90963883 CCAGGAGAAGAGAGAGAAAAAGG + Intronic
1045318369 8:101062831-101062853 ACAGGCGGACAGAGGCCAAAAGG + Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1046526168 8:115384683-115384705 GAAGGAGAAGAGAGGGCAAAGGG - Intergenic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1047174601 8:122528564-122528586 CAAGGGGAGCAGAAGGCCAAGGG + Intergenic
1047424990 8:124736938-124736960 GCAGGGGAACAGAGGGGCAGGGG + Intergenic
1047523661 8:125614936-125614958 GCAGGAGACCAAAGGGCAAAGGG + Intergenic
1047855792 8:128910166-128910188 GAAGGGTAACAGAGGGTAAAAGG + Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1049623757 8:143611058-143611080 CCAGGGCCACAGTGGGTAAAAGG + Intergenic
1050227778 9:3480305-3480327 CCAGTGGAAAAGAGGCCACATGG - Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1050702383 9:8355210-8355232 CCAGTGTATCAGATGGCAAAAGG - Intronic
1051265778 9:15307205-15307227 CCAGCGCAAAGGAGGGCAAAAGG + Exonic
1051991705 9:23160674-23160696 ACAGGGGAACAAAGGTCAAAGGG - Intergenic
1052992949 9:34532455-34532477 CCAAGGGAAGAGGGGACAAACGG - Intergenic
1053478877 9:38401490-38401512 GCAGGGGACCAGAGGGATAAGGG + Intergenic
1055453325 9:76450708-76450730 CCAGGTGAAAAATGGGCAAAGGG - Intronic
1056787477 9:89603683-89603705 CCTGGGGAGTAGAGGGCAAAAGG - Intergenic
1057236900 9:93368292-93368314 CCAGGGTGACAGAGGCCAAGTGG - Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1060394339 9:123305094-123305116 GCAGAAGCACAGAGGGCAAAAGG + Intergenic
1060755600 9:126211012-126211034 CCAGCAGGACAGAGAGCAAAGGG + Intergenic
1060984292 9:127810700-127810722 ACAGGGGAACAGTGGCCACAGGG - Intronic
1061195391 9:129104348-129104370 CCTGGGGAACAGGGGGCACCAGG - Intronic
1061476526 9:130871073-130871095 GCAGGGGAACAGAGAGTGAATGG - Intronic
1062371574 9:136241880-136241902 CCAGGGCCACAGAGGGCGCACGG + Intronic
1062490911 9:136804498-136804520 CCAGAGGAACATGAGGCAAAGGG + Exonic
1062616340 9:137398215-137398237 CCAGGGGAACAGAGGGCGCCCGG - Intronic
1189097406 X:38155011-38155033 CCAGGGGAAAAGAGGATAAAAGG + Intronic
1189481537 X:41395770-41395792 TCAGCTGAACAGAGGGGAAATGG + Intergenic
1190384219 X:49868665-49868687 CCATGCTAACAGAGGCCAAATGG - Intergenic
1191650032 X:63527077-63527099 CCAGGGAAGCAGAGGGCAAGAGG - Intergenic
1192496514 X:71619934-71619956 GGAGGGGAGAAGAGGGCAAAGGG - Intergenic
1194592359 X:95815137-95815159 AGAGGGGCACAGAGGGAAAATGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195787979 X:108547999-108548021 CCAAGGGAAGAGGGGACAAACGG - Intronic
1197880954 X:131165882-131165904 CCAGAAGAACAGAGGTCAGATGG + Intergenic
1198594806 X:138224523-138224545 CCAGGACAGGAGAGGGCAAAGGG + Intergenic
1199654497 X:149981114-149981136 CAAGGGGTATAGAGGGCCAAGGG - Intergenic
1199883044 X:151991147-151991169 CCAGGGGAAATGTGGACAAAAGG - Intergenic