ID: 1086935660

View in Genome Browser
Species Human (GRCh38)
Location 11:92743230-92743252
Sequence CAAGGTGCTCCCCTTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086935660 Original CRISPR CAAGGTGCTCCCCTTAAAAG AGG (reversed) Intronic
902396898 1:16137119-16137141 CAATGTTCTCCCCTGTAAAGTGG - Intronic
907480495 1:54742639-54742661 CCAGCTGCTGTCCTTAAAAGTGG + Exonic
909936590 1:81557948-81557970 CAAGGTGCTCGCCAGAACAGAGG - Intronic
914999594 1:152576841-152576863 CATGATGCTGCCCCTAAAAGTGG - Intronic
915201353 1:154231862-154231884 CAACATGCTTCCCTTAAAGGAGG + Intronic
1063754559 10:8992604-8992626 CAAGCTGTTACCCTTTAAAGAGG - Intergenic
1067004134 10:42645505-42645527 CCAGGTGATCCCCTTAATAAAGG + Intergenic
1068350914 10:55843828-55843850 CAAAGAGCTACCCTTAAATGTGG - Intergenic
1069547255 10:69337684-69337706 CAAGGCGCTCCACTTACAAAAGG - Intronic
1070333423 10:75433606-75433628 CAAGGTGCTACCTCTTAAAGCGG - Intronic
1075570251 10:123536501-123536523 CAAGGAGCACCTCTTAAGAGGGG - Intergenic
1075857749 10:125644832-125644854 TCAGGTGATCCCCTTAAAAAGGG + Intronic
1076909474 10:133379820-133379842 CCAGGTGCTCCCCTTAAACTGGG + Intronic
1083843895 11:65320022-65320044 CAAGCTCCTCCCCTTACAGGTGG - Intronic
1086935660 11:92743230-92743252 CAAGGTGCTCCCCTTAAAAGAGG - Intronic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1092456519 12:8648688-8648710 CAAGGTGCTTCCCTTGCAGGTGG + Intronic
1094496674 12:30993229-30993251 CAAGGTGCCCCCCTTCATGGGGG - Exonic
1099109558 12:78540915-78540937 AAAGATGCTCGCCTTCAAAGTGG + Intergenic
1100212322 12:92410232-92410254 CAAGGTGCCACTCCTAAAAGAGG + Intergenic
1102523695 12:113495451-113495473 CAAACTGCGCCCCTTAAAAATGG - Intergenic
1106323816 13:28668687-28668709 CAAGGTCATACCCTAAAAAGGGG - Intronic
1107310361 13:39070966-39070988 CAAGGTGCACCTCTTTGAAGAGG - Intergenic
1107437144 13:40390062-40390084 CAAGGTTTTCCCTGTAAAAGTGG - Intergenic
1112645920 13:101331600-101331622 CAAGGTGCAACAGTTAAAAGTGG - Intronic
1117463757 14:55972316-55972338 CCAGCTGCTCCCCTTCACAGGGG - Intergenic
1118750968 14:68807659-68807681 CAAGTTGCTCCCCTTGACTGTGG - Intergenic
1118896888 14:69952826-69952848 CAACAGGCTCCCCTTTAAAGCGG - Intronic
1119939982 14:78630176-78630198 CATGGTGCTGTCCTGAAAAGAGG - Intronic
1120345261 14:83280798-83280820 GAAGATGCTCCATTTAAAAGAGG + Intergenic
1120696161 14:87648004-87648026 TTAGGTGATCCCTTTAAAAGCGG + Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1127823906 15:62686394-62686416 CAAGCTGCTCTCCTGAACAGGGG + Intronic
1128477689 15:68011379-68011401 CAAAGTACTCCCTTTAAAAGTGG - Intergenic
1129656185 15:77527059-77527081 CGAGGTGGTCCGCTGAAAAGGGG - Intergenic
1130409608 15:83633738-83633760 CAAGGTGTTTCCCTTAAATCTGG + Intergenic
1130907543 15:88251270-88251292 CCAGGAGATGCCCTTAAAAGTGG + Intronic
1131595009 15:93789171-93789193 CAAAGTCCTCCCAGTAAAAGTGG - Intergenic
1133201892 16:4208843-4208865 CAAGGGGATCCCCTTGGAAGGGG - Intronic
1136866863 16:33766354-33766376 CAAGGAGCTCCCCAGCAAAGCGG + Intergenic
1203105299 16_KI270728v1_random:1349848-1349870 CAAGGAGCTCCCCAGCAAAGCGG - Intergenic
1203128215 16_KI270728v1_random:1612520-1612542 CAAGGAGCTCCCCAGCAAAGCGG + Intergenic
1149518788 17:57302767-57302789 TAAAATGCTCCCCTCAAAAGAGG - Intronic
1152341424 17:79728035-79728057 CAAGGAGCTCCCCAGCAAAGCGG + Intergenic
1168439967 19:56356205-56356227 CCAGGTGCTCACCTTAATAAAGG - Intronic
930200476 2:48548094-48548116 CAAGGAGCTCCACTTTAAGGGGG - Intronic
932072176 2:68631695-68631717 CAAGGTGCTTCCATACAAAGTGG + Intergenic
933001147 2:76925174-76925196 CCAGGTGAGCCCTTTAAAAGAGG + Intronic
934964126 2:98705076-98705098 CAAGAAGCTCCCCTGAGAAGAGG + Intronic
935839884 2:107097812-107097834 CAATGTCCTCCCCTTGAGAGTGG - Intergenic
938025724 2:127946235-127946257 AAAGGTGCTCCCCATAACAGTGG + Intronic
940185537 2:150980957-150980979 CAAGGCGTTTCCCTTAAAAAAGG - Intergenic
943199216 2:184797586-184797608 CTAAATGCTCCACTTAAAAGAGG - Intronic
946877770 2:224147045-224147067 AAAGGGACTGCCCTTAAAAGAGG + Intergenic
947046361 2:225991360-225991382 CATGGTGATCCTCTTAAGAGAGG + Intergenic
947390211 2:229631184-229631206 TAAGGTGCTTTCCCTAAAAGTGG - Intronic
1172218001 20:33250172-33250194 CAAGGAGTTGCCCTTCAAAGGGG + Intergenic
1174707463 20:52670941-52670963 CAGGGAGCTCCACTCAAAAGTGG + Intergenic
1175454639 20:59102732-59102754 CAAAGTGCTGCCCTCAAAACTGG - Intergenic
1178405146 21:32317423-32317445 CATGGTGCTCACCTGTAAAGAGG - Intronic
1181499640 22:23308690-23308712 GAACGTGCTCCCCATAAAACGGG + Intronic
1184572404 22:45334115-45334137 CAAGGAGCACTACTTAAAAGAGG - Intronic
1185138152 22:49085359-49085381 CAAGATGCTCCCCTGAGCAGAGG - Intergenic
1185399239 22:50607402-50607424 CTAGCTGCTCCCCTTACACGCGG - Intronic
1185419846 22:50729181-50729203 CATGGGGCTCCCCTTAAAGCAGG - Intergenic
952236823 3:31488519-31488541 GAGGGTGCTGCCCATAAAAGAGG + Intergenic
955455022 3:59110823-59110845 CAACGTCCACCCTTTAAAAGTGG - Intergenic
960867357 3:122215271-122215293 CAAGGGGCTTTACTTAAAAGGGG - Intronic
962606853 3:137039338-137039360 CAAGGATCTCCCCCTAGAAGAGG - Intergenic
964159864 3:153634005-153634027 CAAGGTCCTCCCCAAAAATGTGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967891041 3:194364867-194364889 CAAAGTGCTCCCCTGAAACCCGG + Intronic
968207051 3:196812354-196812376 CAACGGGCTCAACTTAAAAGAGG - Intronic
973013335 4:45105182-45105204 CCAGGTCTTCCCCTTAAAAAGGG - Intergenic
973333433 4:48932827-48932849 CAAGGTGCTCACTTCAAAATTGG - Intergenic
974133589 4:57787344-57787366 CAAACTGGTCCCCTTAAAACTGG - Intergenic
979230805 4:118347252-118347274 CAAGATGTAGCCCTTAAAAGTGG + Intronic
985769103 5:1797856-1797878 CAAGGAGCTCCCCTTGCTAGAGG - Intergenic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
995235910 5:109830215-109830237 CAATGTGATTCCCTTATAAGAGG - Intronic
997758964 5:136426315-136426337 CAAGGTTCTCTCTTTAAAATGGG - Intergenic
1000770542 5:165348143-165348165 CAAGTCGCTCCTCTTAAAAAAGG + Intergenic
1006761240 6:36463572-36463594 CAAGGTGATACCATTAAGAGGGG + Intronic
1010433154 6:75801262-75801284 CAAGGTGCTTCACAGAAAAGAGG + Intronic
1013240686 6:108242776-108242798 TTAGGTGAGCCCCTTAAAAGGGG + Intronic
1015120383 6:129694502-129694524 CAAGTTTTTCCACTTAAAAGTGG - Intronic
1024556778 7:50610477-50610499 CAAAGTGCTTCCCTGCAAAGTGG + Intronic
1033529878 7:142251095-142251117 TAAGGTGCTCCTCTGAAAAATGG + Intergenic
1038161639 8:25045232-25045254 TAAGGTGCTGCCCTTATGAGTGG - Intergenic
1046034168 8:108821400-108821422 AGAGGTGCTCCCCTGAAAATGGG - Intergenic
1048349422 8:133604046-133604068 AAAGGTACTGCTCTTAAAAGAGG - Intergenic
1052155816 9:25188773-25188795 CATGGTGCTCACCATAAAGGAGG + Intergenic
1052989480 9:34510788-34510810 AAAGGTGGTCCCTTTAAAGGGGG - Intronic
1057821165 9:98332153-98332175 CCAGGTGCTCCCCTGCAAAATGG + Intronic
1058226800 9:102374216-102374238 CTATGTGCTCCACTTAAAAGGGG - Intergenic
1059826754 9:118038646-118038668 GAATGTGCTTCACTTAAAAGGGG + Intergenic
1060276831 9:122188856-122188878 CAAGGTGCTCCCCGGACAGGAGG - Intronic
1187608875 X:20918340-20918362 AAATGTGCTCCCCTTAAAGGAGG - Intergenic
1188416697 X:29944178-29944200 CAAGTTATTCCCCTAAAAAGCGG + Intronic
1195771093 X:108352306-108352328 CAAAGTCCTCCCCTCAAAAGTGG + Intronic