ID: 1086936147

View in Genome Browser
Species Human (GRCh38)
Location 11:92747459-92747481
Sequence GGCCTCCAGGAAGCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 351}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086936140_1086936147 2 Left 1086936140 11:92747434-92747456 CCCACAAAACCATTTTTTCCTCC 0: 162
1: 561
2: 992
3: 1534
4: 1875
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936136_1086936147 14 Left 1086936136 11:92747422-92747444 CCCTGGGCCCAGCCCACAAAACC 0: 142
1: 297
2: 762
3: 1107
4: 1461
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936139_1086936147 6 Left 1086936139 11:92747430-92747452 CCAGCCCACAAAACCATTTTTTC 0: 80
1: 285
2: 569
3: 792
4: 1082
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936137_1086936147 13 Left 1086936137 11:92747423-92747445 CCTGGGCCCAGCCCACAAAACCA 0: 145
1: 304
2: 823
3: 1159
4: 1605
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936141_1086936147 1 Left 1086936141 11:92747435-92747457 CCACAAAACCATTTTTTCCTCCT 0: 169
1: 559
2: 1028
3: 1583
4: 1949
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936138_1086936147 7 Left 1086936138 11:92747429-92747451 CCCAGCCCACAAAACCATTTTTT 0: 74
1: 381
2: 863
3: 1427
4: 2397
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351
1086936143_1086936147 -7 Left 1086936143 11:92747443-92747465 CCATTTTTTCCTCCTAGGCCTCC 0: 112
1: 657
2: 1305
3: 1471
4: 1628
Right 1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG 0: 1
1: 0
2: 3
3: 40
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086936147 Original CRISPR GGCCTCCAGGAAGCCTGTGA TGG Intronic
900174313 1:1285096-1285118 GGCCTCCAGGCAGCCTGGCCAGG - Intronic
900817005 1:4855705-4855727 GCCCCCCAGCAAGCCTGTGTTGG + Intergenic
901828885 1:11880142-11880164 GGCCTTCATGAAGCCTTGGAAGG + Intergenic
901850492 1:12011899-12011921 TGCCTCATGGAAGCCTTTGAGGG + Exonic
902887442 1:19416038-19416060 GGCCTCCACACAGCCGGTGAAGG + Intronic
903185126 1:21624559-21624581 GGTCTCCAGCAAGCCAGTGCTGG - Intronic
903216887 1:21848281-21848303 CCCCTCCAGAAAGCCTGTTAAGG + Intronic
903537371 1:24076020-24076042 GCCCTCCAGCAAGCCCCTGAGGG - Intronic
903662251 1:24985306-24985328 GGCCTCCAGGAAGCCTGGGGAGG + Intergenic
903769930 1:25757408-25757430 GGTCTGCAGGAAGGCTGTGGTGG - Intronic
904309856 1:29621931-29621953 GGGCTGCAGGGAGCCTTTGAAGG + Intergenic
904905674 1:33895699-33895721 GCCCTCCAGAAAGGCTGAGAGGG + Intronic
904946306 1:34201082-34201104 AGCCACCCTGAAGCCTGTGAGGG - Intronic
907855507 1:58299884-58299906 TGCCTCCAGGAAGCATGTGGAGG - Intronic
910279778 1:85486577-85486599 GGCATCCAGTAAGCATTTGATGG - Intronic
911150252 1:94591408-94591430 GCCCTCCAGCAAGCCTGGGTCGG - Intergenic
912546979 1:110457940-110457962 AGCCTCCAGGAAGACTATGGTGG + Intergenic
914215571 1:145624902-145624924 GGCCTCAAGGAAGTCTGAGAAGG + Intronic
914467521 1:147945284-147945306 GGCCTCAAGGAAGTCTGAGAAGG + Intronic
915015362 1:152728041-152728063 TGCCTTCAGGAAGTCTGTCATGG - Intergenic
915146135 1:153796689-153796711 GAGCTCCAGGAAGCCAGGGATGG - Intergenic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
918234230 1:182562703-182562725 GGGCTCCAGGGAGGTTGTGAGGG + Intergenic
918446650 1:184623607-184623629 GGACTCCAGTGTGCCTGTGAGGG + Exonic
920051198 1:203166090-203166112 GCCCTGCAGGAGGCCTGGGAGGG + Exonic
921572776 1:216798483-216798505 GGCCTCCAGAAAGCCAGGAAGGG + Intronic
922100092 1:222472480-222472502 GGCCTCCTGGCAGCCTCTGTAGG - Intergenic
922766993 1:228161249-228161271 TGCCTCCAGTCTGCCTGTGATGG - Intergenic
922803617 1:228374924-228374946 GGGCTGCAGGAGGCCTGAGAAGG + Intronic
923433695 1:233948931-233948953 GGCCCCCTGTAAGGCTGTGAGGG - Intronic
923500246 1:234558648-234558670 GGCCTCTAGGAAGCCGGTACAGG - Intergenic
923941934 1:238837482-238837504 GGCCTTCAGGAAGGCAGTTAAGG + Intergenic
1062792567 10:318295-318317 AGCTTCCAGGAAGGCTGGGAAGG - Intronic
1062980075 10:1714723-1714745 TGGCTCCACGAAGCCTGTGAGGG + Intronic
1063077675 10:2733025-2733047 GGCCTTCAGGAAGCAGGAGATGG - Intergenic
1067025976 10:42844750-42844772 TGCCTTCAGGAAGCCTCTGCTGG + Intergenic
1067429869 10:46236009-46236031 GGATTCCAGGCAGCCTGGGAAGG - Intergenic
1069541411 10:69296900-69296922 GGCATCCAGGAAACCAGAGAGGG + Intronic
1069850302 10:71399864-71399886 TGCCTCTAGGACGCCTGAGACGG + Intronic
1070583968 10:77747192-77747214 CTCCTCCAGGAAGCCTCTGAAGG - Intergenic
1070643989 10:78188818-78188840 GGGCCCCTGGAAGACTGTGAGGG - Intergenic
1070663555 10:78327891-78327913 GGCCTCCAAGCAGCATGTGCAGG + Intergenic
1071493767 10:86154019-86154041 GGCCTTCCGGCGGCCTGTGATGG - Intronic
1071666601 10:87564407-87564429 GGCCCCCAGGTAGCATGTGCAGG - Intergenic
1071672893 10:87626608-87626630 GGCACCCAGGAAGGCTGTGAAGG - Intergenic
1073303012 10:102482339-102482361 GGCCTCCTGGAAACTAGTGAGGG + Intronic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1075517368 10:123119468-123119490 TGCCCCCAGGAAGACTGGGAAGG - Intergenic
1076627934 10:131833435-131833457 GCCCTCCAGAAACCCTGGGATGG + Intergenic
1076716842 10:132370375-132370397 GGGCTGCAGGGAGCCTGTCATGG - Intronic
1076834659 10:133014967-133014989 GGCCTCCCAGAAGCCAGGGAGGG - Intergenic
1076947345 10:133660250-133660272 GGCATCCCAGGAGCCTGTGAGGG + Intergenic
1077172308 11:1172578-1172600 TGCCTCCAGGAGGGCTGGGAGGG + Intronic
1077897476 11:6464268-6464290 GGCCTGGAGGAAGCCTGGTAGGG - Intronic
1078778451 11:14414988-14415010 GGTTTCCTGGAAGCCTGTGAGGG + Intergenic
1079102750 11:17551924-17551946 GGCCACCAGGAAGCCTGCCTGGG + Intronic
1080648975 11:34207937-34207959 GGCCTCCAGGAACCCTTGGCAGG - Intronic
1081612479 11:44570901-44570923 GGCCTCCAGGAAGCCCATCCTGG + Intronic
1081864461 11:46352084-46352106 GGCCTCCAGGGAGCCGAGGAGGG - Intronic
1082260478 11:50073570-50073592 GGCCTCCCGGCAGCCTCTGTAGG - Intergenic
1083680589 11:64349962-64349984 GGCATCAAGGAAGCCAGCGATGG + Intronic
1084272348 11:68036123-68036145 GGAGTCCAGGAGGCCTTTGAGGG + Intronic
1084693374 11:70739639-70739661 GGGCCCCAGGGAGGCTGTGATGG + Intronic
1085261112 11:75205213-75205235 GGCCTTCAAGAGGCCTGTGTGGG + Exonic
1085398161 11:76218104-76218126 GAGCTCCTGGAAGCCTATGAGGG + Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1087088215 11:94241577-94241599 AGACTCCAGGGAGCCTTTGAAGG + Intergenic
1087949221 11:104199664-104199686 GGCCTGGAGGAAGCATGAGAGGG - Intergenic
1088686252 11:112286755-112286777 TGCCTCCAGGAAGCCTGTCCTGG - Intergenic
1089619243 11:119713114-119713136 GGCATCCAAGCAGCCTGTGGGGG + Intronic
1090970716 11:131640429-131640451 AGCCTGCAGGAAGCCTCTGACGG - Intronic
1091197992 11:133747922-133747944 GGCCTCCAGGATGCCACAGATGG + Intergenic
1091453844 12:590622-590644 GGGCGCCTGGAAGCCTGTCAAGG + Intronic
1096976219 12:55700520-55700542 GGACCCCAGGAAGCCTGGGTTGG - Intronic
1097161199 12:57047858-57047880 GGCCTCCAGAAGGCCAGGGAAGG + Intronic
1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG + Intronic
1102498488 12:113335326-113335348 GGACTGCAGGAAGCCGGAGAGGG + Intronic
1102720643 12:115013311-115013333 GGGCTCCAGGAAGCCAGCCAGGG + Intergenic
1103459202 12:121090202-121090224 GGACTCCAGGAATCCAGAGATGG - Intergenic
1104635426 12:130435505-130435527 GGTCCCCAAGAAGGCTGTGAAGG - Intronic
1104944333 12:132408967-132408989 GGCCCCCAGGACACTTGTGAGGG - Intergenic
1105240000 13:18599974-18599996 AGCCTCCAGGAATCCGCTGAAGG + Intergenic
1106404239 13:29459932-29459954 GTCTTCCAGGAAGCCTGGGGAGG - Intronic
1106564305 13:30871561-30871583 GGCCTCCCTGCAGCCTGGGAAGG - Intergenic
1111118910 13:83820943-83820965 GGACTCCAGAAAGCCTCTCAAGG - Intergenic
1111724866 13:91994366-91994388 GGCATCAAAGAAGCCTGTGTTGG + Intronic
1113095612 13:106660863-106660885 GCCCTCCACGAAGCCCCTGATGG + Intergenic
1113707870 13:112445927-112445949 GCCCTCCAAGGAGCCTGTGATGG + Intergenic
1114065387 14:19055052-19055074 AGCCTCCAGGAATCCGCTGAAGG + Intergenic
1114096875 14:19344950-19344972 AGCCTCCAGGAATCCGCTGAAGG - Intergenic
1115510333 14:34132070-34132092 GTCCTCCAAGAAGGCTGTGACGG - Intronic
1115707551 14:36014296-36014318 GGGGTCCATGAAGTCTGTGACGG + Intergenic
1118003252 14:61543141-61543163 GGCCTCCTGCAAGCCAGGGAAGG - Intronic
1118258507 14:64225659-64225681 GGGCTCCAGGGAGCCCGTGCTGG - Exonic
1118360299 14:65051071-65051093 GGCCTGCAGCCAGCCTGAGATGG + Intronic
1119036871 14:71237543-71237565 GGCCTTTAGAAAGCTTGTGAGGG - Intergenic
1119129609 14:72159339-72159361 GGCCTCCGGGCAGAGTGTGAGGG + Intronic
1119521096 14:75285709-75285731 GTCATCCAGGAAGACAGTGAAGG - Intergenic
1120649580 14:87115538-87115560 GGCACCCAGGAGGACTGTGAAGG - Intergenic
1120840122 14:89078251-89078273 GGCCTCCGGGACGCCTGCAATGG + Intergenic
1121408745 14:93734915-93734937 GGCTCCCAGGAAGGGTGTGAGGG - Intronic
1121838835 14:97116093-97116115 GTGCTCCAGGAAGCCTTAGAAGG - Intergenic
1122428025 14:101622979-101623001 GGGCTTCAGGCAGCCTGGGAAGG + Intergenic
1122594398 14:102879157-102879179 AGCCTCTAGGCAGCCTCTGAGGG - Intronic
1123491235 15:20784093-20784115 AGCCTCCAGGAATCCGCTGAAGG - Intergenic
1123547737 15:21353184-21353206 AGCCTCCAGGAATCCGCTGAAGG - Intergenic
1123924546 15:25094773-25094795 GGGCTCCAGGTGGCCTGTGGTGG - Intergenic
1124664642 15:31581746-31581768 GGCCTCCAGGCCTCCTGTGATGG + Intronic
1127798144 15:62455626-62455648 GGCCTCCAGCAACCCTTTGGTGG + Intronic
1127855105 15:62947790-62947812 GTCCTCAAGGAAGACTGAGAAGG - Intergenic
1128579230 15:68797253-68797275 GGCCTCCAAGATGCCTGGGGTGG + Intronic
1129207233 15:74044467-74044489 GGCAGCCAGGAAGCCCGAGATGG - Exonic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129743275 15:78000630-78000652 GACCTCCAGGAAGCCTGGCATGG + Intronic
1129842201 15:78750812-78750834 GACCTCCAGGAAGCCTGGCATGG - Intergenic
1130423157 15:83768590-83768612 GGCCTTCAGAAAGCTTGAGAAGG + Intronic
1130790049 15:87144623-87144645 GACCTCCCTGAAGCCTGTGAAGG - Intergenic
1130906168 15:88242148-88242170 TGACCCCAGGAAGCCTGGGAGGG - Intronic
1131075046 15:89490239-89490261 GGCCTCAGGGAAGCCTGGAAGGG - Intronic
1131658397 15:94485649-94485671 GGCCTCCAGGCAGCTTGTTTGGG - Intergenic
1202956067 15_KI270727v1_random:80414-80436 AGCCTCCAGGAATCCGCTGAAGG - Intergenic
1132808686 16:1787527-1787549 GGCCTCCCGAGAGCCTGTGATGG + Intronic
1132845708 16:1999937-1999959 GCCCACCAGGAAGGCTGGGAAGG - Exonic
1133767595 16:8848695-8848717 CGCCTCCAGGAAGCCAGCCAGGG - Exonic
1136091107 16:27920690-27920712 AGCCTGCAGGAGTCCTGTGATGG + Intronic
1136160138 16:28414671-28414693 AGCCTCCACGGAGCCTGTGTGGG + Intergenic
1136202950 16:28700620-28700642 AGCCTCCACGGAGCCTGTGCGGG - Intronic
1137288899 16:47038152-47038174 GGCGTCCAGGAAGCAAGGGAGGG + Intergenic
1138502157 16:57453569-57453591 GCCCTGCAGCAAGCCTGGGATGG - Intronic
1139053849 16:63157510-63157532 GGCGTCCTGGGAGCCTGTGGAGG - Intergenic
1140055428 16:71521567-71521589 GGCCTCCAGGAAGATAGTGGTGG - Intronic
1140217957 16:73023399-73023421 GGCCTGGAGCAGGCCTGTGAGGG + Intronic
1141653070 16:85403891-85403913 GGCCTCCCAGCAGCCTCTGAAGG - Intergenic
1141880764 16:86857393-86857415 TGTCTCCAGGAAGCCTCTGATGG - Intergenic
1141883000 16:86872228-86872250 GGCCTCCAGGAACACTTTCAAGG + Intergenic
1143322900 17:6079596-6079618 GGAGTCCAGGAGGCCTGGGAAGG + Intronic
1144105272 17:11978627-11978649 CCCCTCAAGGAAGCCTGAGAAGG + Exonic
1144138335 17:12320823-12320845 GGACTCCAGGAAGGCTGAGGAGG - Intergenic
1145244986 17:21262806-21262828 GGGCTGCAGGAGCCCTGTGAAGG - Intergenic
1146651036 17:34606587-34606609 GGCTTCCAGGAAGTCTGTGAGGG - Intronic
1147167734 17:38602355-38602377 GGGCCCTAGGAAGCCAGTGAGGG + Intronic
1147325951 17:39669719-39669741 GACCTCCAGGAAATCTGTCATGG - Exonic
1148441970 17:47716152-47716174 GGCCTCTTGGTACCCTGTGAGGG + Intergenic
1148906341 17:50914908-50914930 GGCCTCAGGGATGGCTGTGAGGG + Intergenic
1149427892 17:56572374-56572396 GAGCTCTAGGAAGCCTCTGAGGG - Intergenic
1150596301 17:66608719-66608741 GGTCTCCAGGAAGGTTGGGAAGG + Intronic
1151297613 17:73197016-73197038 GGCCAGCAGGAAGTCTGTGAGGG - Exonic
1151971120 17:77457993-77458015 TGAGTCCAGGAAGCCTGTGGGGG - Intronic
1152068886 17:78125585-78125607 GGCCTTCAGGCAGCCTGCTAAGG + Intronic
1152225576 17:79091154-79091176 GGCCGCCTCGAAGCCTGTGCTGG - Intronic
1154448832 18:14458800-14458822 AGCCTCCAGGAATCCGCTGAAGG - Intergenic
1156297701 18:35807973-35807995 GACCTCCAGGGAGCATGGGAGGG - Intergenic
1158405877 18:57158527-57158549 GACCTGCAGGAAGCCAGGGAGGG - Intergenic
1158905927 18:62011691-62011713 GGCTTCCAGGAAGAGTGTGCTGG + Intergenic
1160680684 19:410635-410657 CGCCTCCAGGAAGCCTGGGCAGG + Intergenic
1160975617 19:1790870-1790892 GGCCCCCAGGCAGCCAGTGCGGG - Intronic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1161399115 19:4059765-4059787 GGCCTCCAGGAGGCCTAGGTGGG - Intronic
1162234947 19:9301466-9301488 AGCCTCCAGAAATGCTGTGAAGG + Intronic
1162455883 19:10784498-10784520 GGCCTCCAGGGAGCCTGGAGGGG + Intronic
1163641833 19:18466494-18466516 GGCCCCCAACAAGCCTGTCATGG + Intronic
1163831034 19:19547280-19547302 GGCCTCCAGGGCACCTGGGATGG + Intergenic
1164458516 19:28428241-28428263 GCCCTCCAGGAACCCTGGGGAGG - Intergenic
1165161673 19:33820309-33820331 GGCTCCCCGGAGGCCTGTGATGG - Intergenic
1165715978 19:38046210-38046232 GGCCTCCCAGCAGCCTGGGATGG - Intronic
1165784905 19:38455624-38455646 GACCTCCAGGATGCCTGCCAGGG - Exonic
1166703596 19:44896140-44896162 GGGCTCCAGGAGGCCAGTGCTGG - Intronic
1166887575 19:45971527-45971549 GACCCCCTGGATGCCTGTGAGGG - Intronic
925507397 2:4583780-4583802 GGCTTCCTGGAGGCCTGTGTGGG + Intergenic
926758031 2:16251706-16251728 GGCCTCCAGATAGCCTGTTGGGG + Intergenic
927048285 2:19302087-19302109 GGCCCCCTGGAAGACTGTGTAGG - Intergenic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
930090638 2:47528919-47528941 GGCCCCCAGCCACCCTGTGAGGG + Intronic
932073987 2:68646135-68646157 GGCCACCAGGAAGTCAGAGATGG - Exonic
934613252 2:95756042-95756064 GGGCTCCAGGAAGGCTCAGAGGG + Intergenic
934647642 2:96068378-96068400 GGGCTCCAGGAAGGCTCAGAGGG - Intergenic
936094871 2:109523826-109523848 GGCCACCAAGCAGCCTGCGACGG + Intergenic
937304223 2:120861350-120861372 TGCCTCCAGGAAGCCTGCAGGGG - Intronic
937917963 2:127108259-127108281 TTCCTCCAGGAAGCCTCTCAGGG - Intergenic
937956589 2:127425139-127425161 GGCTTCCAGGAAGGCAGTGCAGG - Intronic
938510565 2:131937844-131937866 GGCTTACAGGAAAACTGTGAGGG - Intergenic
938650931 2:133382640-133382662 GGCCTCCAAGAAGCCTTTTCAGG + Intronic
938695515 2:133831981-133832003 GGACTCAAGGAAGCCAGAGATGG - Intergenic
939022163 2:136971131-136971153 AGTTTCCAGGAAGTCTGTGATGG + Intronic
939488550 2:142848431-142848453 GTCTCCCAGGAACCCTGTGAGGG + Intergenic
942090255 2:172483108-172483130 CTCCTCCAGGAAGCCTGTCCTGG - Intronic
943836249 2:192517367-192517389 AGCCTGAAGGAAGCCAGTGATGG + Intergenic
946178979 2:217938629-217938651 GGCCTCCAGGAAGCCTGCCCTGG - Intronic
948569313 2:238907376-238907398 GTCCTCCAGGAAGCCGGGGTGGG - Intronic
948809015 2:240465633-240465655 GACTTCCAGGACGCCAGTGAGGG + Exonic
1169404712 20:5314061-5314083 GGCCACCAGGAAGTCGGAGATGG + Exonic
1169557449 20:6766536-6766558 GGGCTCCTGGAATCCTGGGAAGG + Intergenic
1170692002 20:18624636-18624658 AGGCTCAAGGAAGCCTGTGTGGG - Intronic
1170882082 20:20305578-20305600 GGCCGCAGGGAAGCGTGTGAGGG - Intronic
1171206176 20:23283152-23283174 GGCCTCCTGCAAGCCAGTGTTGG + Intergenic
1171484721 20:25478468-25478490 GGCTTACAGAAAGCCTGTGCTGG - Intronic
1172122764 20:32608352-32608374 GTCCGCCAGGCAGCCTGTGAGGG - Exonic
1172173422 20:32958447-32958469 AGACTACAGGATGCCTGTGATGG + Intronic
1173784070 20:45779857-45779879 GGCCTCCAGGAAGCCTGGCCTGG - Intronic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1174038423 20:47682532-47682554 GTCCTCCAGGAAGGATGGGAGGG + Intronic
1175654893 20:60761407-60761429 TCCCTCCAGCAAGCCTGGGAAGG - Intergenic
1175777455 20:61662312-61662334 CGGCTCCAGGAAGCCAGCGATGG - Intronic
1175871419 20:62211150-62211172 GACATCCAGGAAGCCTCTGTGGG - Intergenic
1176231668 20:64036185-64036207 GTCCTCCAGGCAGCCTGTCCAGG + Intronic
1177461812 21:21422162-21422184 GGCCTCCAACAAGCCTGTTTGGG - Intronic
1178493332 21:33067974-33067996 GGCTTCCAGGAAGCCCAGGAGGG - Intergenic
1179935686 21:44602275-44602297 GGCTGCCAGGACGCCTGGGAAGG - Intronic
1179957385 21:44749246-44749268 GGCCTCCAGGTGGGGTGTGAGGG - Intergenic
1179957489 21:44749626-44749648 GGCCTCCAGGTGGGGTGTGAGGG + Intergenic
1180099574 21:45578269-45578291 GCCCTTCAGGGAGCCTGGGAGGG + Intergenic
1180157380 21:45984096-45984118 GCCCTCCTGGAAGGCTGTGCAGG - Intronic
1180483877 22:15777672-15777694 AGCCTCCAGGAATCCGCTGAAGG + Intergenic
1180867783 22:19129296-19129318 TGAATCCAGGATGCCTGTGATGG + Intergenic
1181018369 22:20084620-20084642 GACCTCCAGGCAGGCTCTGAAGG - Intronic
1181468291 22:23122544-23122566 GGACACTAGGAAGTCTGTGAGGG - Intronic
1182359828 22:29739936-29739958 GGCCTCAGGGTAGCCAGTGAAGG - Intronic
1182776222 22:32833221-32833243 GGCCCCCAGCAAGACTGAGATGG + Intronic
1183017258 22:34999386-34999408 GGCACCCAGGCAGCCTGGGATGG + Intergenic
1183061023 22:35336488-35336510 TGGCTGCAGGAAGGCTGTGACGG - Intronic
1183101588 22:35587526-35587548 GGCCCCCAGTGAGCCTGAGAGGG - Intergenic
1184586478 22:45451576-45451598 GGGCATCAGGAAGCCTGGGATGG + Intergenic
1185368455 22:50447557-50447579 GGCCTTCATGAAGCCTTGGAAGG - Exonic
1185368510 22:50447763-50447785 GGCCACAAAGAAGCCTTTGATGG + Intronic
949837052 3:8280546-8280568 TTCCTCCAGGAAGCCTTTGCTGG + Intergenic
950225472 3:11230101-11230123 GGCCTCTAGAAGGCCAGTGACGG + Intronic
950265539 3:11570266-11570288 GGCCTCCTGGCAGCTTGGGATGG - Intronic
950410050 3:12830340-12830362 AGCCTCCCGGAACCCTGTGGTGG - Intronic
950467938 3:13166505-13166527 GGCCACCTGGAAGCCAGTAAGGG - Intergenic
952942561 3:38455054-38455076 GGCCTCCAGGAGGCACGTGGCGG + Intronic
953687982 3:45093301-45093323 GGCCTCCAGGCAGGGTCTGACGG - Exonic
953883426 3:46702888-46702910 GGCCTCAGGGCAGCCTGTGAGGG - Intronic
954093085 3:48301103-48301125 GCCCTCCAGGAAGCGAGTGGTGG - Intronic
956619510 3:71207040-71207062 TGCCACAAGGAAGCCTCTGAAGG + Intronic
957080109 3:75630166-75630188 GGCATCCCAGGAGCCTGTGAGGG - Intergenic
960203017 3:114860703-114860725 GATCTCCAGGATGACTGTGAGGG - Intronic
960262154 3:115580220-115580242 GGGCTGCAGTGAGCCTGTGATGG + Intergenic
960551250 3:118978267-118978289 GACCTGCAGGTAGCATGTGAGGG - Intronic
962312159 3:134334326-134334348 GGGCTCCAGGAAAGCTGGGATGG + Intergenic
962989635 3:140566364-140566386 GGGCTCCAGGAAGCTGGAGAAGG - Exonic
968661489 4:1800559-1800581 GGTCTCCAGGAGGCCTGGGAGGG + Intronic
969120744 4:4909152-4909174 GTTCTCCAGGAAGGCTTTGAAGG - Intergenic
969260897 4:6032828-6032850 GGGCACCAGGGAGCCAGTGAGGG + Intronic
969375701 4:6761933-6761955 CAGCTGCAGGAAGCCTGTGAAGG - Intergenic
969623767 4:8292261-8292283 GGGCTCCAGGAAGCCTCAGGCGG + Intronic
969700218 4:8763959-8763981 GGCCTCCTTGCAGCCTGTGCGGG - Intergenic
969864336 4:10063972-10063994 GGCCTCCAGAAAGCAGGAGAAGG + Intergenic
970193034 4:13533147-13533169 GCACTCCAGGAAGCCTAGGACGG - Intergenic
970252554 4:14131100-14131122 GGAGTCCTGGAAGTCTGTGATGG - Intergenic
970425094 4:15938510-15938532 GGCCTAGAGGAAGCGTTTGATGG - Intronic
971235974 4:24842742-24842764 GTCCTCCATGAAGCCTGTCCAGG + Intronic
975108920 4:70601454-70601476 GGCTTCAAGGATGGCTGTGATGG - Exonic
976178109 4:82374269-82374291 GGACTCCAGGAATCCTCGGAAGG - Intronic
978184720 4:105843754-105843776 GTCCTCCAGAAAGCATGTGTTGG - Intronic
979190438 4:117850042-117850064 GGCCTGCAGGTAGCATGTGCAGG - Intergenic
979218088 4:118190538-118190560 GGCATCCAGGAGGACTATGAAGG + Intronic
981055185 4:140353069-140353091 AGCAGGCAGGAAGCCTGTGAGGG - Intronic
982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG + Intronic
985450802 4:190061050-190061072 GGCATCCCAGGAGCCTGTGAGGG + Intergenic
985606861 5:862463-862485 GGCCACCAGGAAGCCGGGCAGGG + Intronic
985915265 5:2913394-2913416 TGCCTCCACCAAGCCTGTGAGGG + Intergenic
987074657 5:14369552-14369574 GGCAGGCAGGAAGCCTCTGATGG - Intronic
987266612 5:16262580-16262602 GGCCTCCATCATGCCTCTGAGGG - Intergenic
987379201 5:17268666-17268688 TTTCTCCAGGAAGCCTGTCAGGG - Intronic
987439058 5:17933069-17933091 GGCCTCCAGGCAGCTTGTTTAGG - Intergenic
987979369 5:25061311-25061333 GTCCTTCAGGCAGCCTCTGAGGG - Intergenic
988563113 5:32298555-32298577 GCCCTCCAGGTAGACTGTAAAGG + Intronic
989963352 5:50441122-50441144 GGCCTCCAGCAGGCCGGGGAGGG + Exonic
990357626 5:54985848-54985870 GGGCTCAAGGACGTCTGTGAAGG + Intronic
990722856 5:58717509-58717531 GACCTTCAGGGAGCCTGTTAGGG + Intronic
992192957 5:74312218-74312240 GTCCGCCAGGAAGACAGTGAGGG + Intergenic
992884114 5:81140732-81140754 AGCCTGCAGGGAGCCTGGGAAGG - Intronic
995694681 5:114865957-114865979 CTCCTCAAGGATGCCTGTGATGG + Intergenic
997018300 5:129964080-129964102 GGCATCAAGGAAGTCTGTGCTGG + Intronic
997396289 5:133562599-133562621 GGCTTCTAGCAAGGCTGTGAGGG - Intronic
997675767 5:135711941-135711963 GGCCTGCAGGATGCCTGGGTGGG - Intergenic
999641787 5:153679840-153679862 GCCCTCCAGGTAGGCTGTGCTGG - Intronic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
999776043 5:154813968-154813990 GGCCTGCTGGAAGACTGGGAGGG - Exonic
1001292236 5:170471926-170471948 GGCTGCCAGGAGGCCTCTGACGG - Intronic
1001680641 5:173554607-173554629 GGCCTCCTGGAAGACTGTGTTGG - Intergenic
1001959044 5:175869095-175869117 GGCCTTCGGGAAGCATGTCAAGG + Intronic
1002085892 5:176775102-176775124 ATCCTCCAGGAAGCCTGTCCTGG + Intergenic
1002134401 5:177098890-177098912 GGCCTCCATGAAGGCTGTCCTGG - Intergenic
1003162320 6:3646715-3646737 GGACTCCAGGAAGCCTGAGCAGG - Intergenic
1003244620 6:4373550-4373572 TTCCTCCAGAAAGCCTGAGAAGG + Intergenic
1003307094 6:4939378-4939400 GGGTTCCAGGACTCCTGTGATGG - Intronic
1003395878 6:5751630-5751652 GGCCTAGTGGAAGCCTGTGCTGG + Intronic
1003567053 6:7230672-7230694 GGGTTCCAGGAAGGCAGTGAGGG - Exonic
1004001773 6:11602810-11602832 GGCATCCAGGAAGGCTGAGGTGG - Intergenic
1004299579 6:14445018-14445040 GGCCTACCAAAAGCCTGTGATGG - Intergenic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1006140899 6:31928984-31929006 TGCATCCAGGAAGCCTCTGTGGG + Intronic
1006188044 6:32191588-32191610 GGCATATAGGAAACCTGTGAAGG + Intronic
1006614904 6:35319529-35319551 GGCCTCCATGCAGGCTGAGATGG + Exonic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1008189060 6:48431956-48431978 GGCTTTCAAGAAGCCTGTTAGGG + Intergenic
1010342298 6:74768383-74768405 GGCCTCCAGGAACTCAGTCAAGG + Intergenic
1010450198 6:75993935-75993957 AGCTTCCAGGTAGTCTGTGAGGG + Intronic
1010735300 6:79437184-79437206 GGACTCCAGGGAGCCCGTGGAGG + Intergenic
1012612661 6:101234874-101234896 AGCCTCCAGGAAGGTTGTGTAGG + Intergenic
1012654316 6:101795508-101795530 GGCCTCCAGGAAGCTTGCTTCGG + Intronic
1013191289 6:107806281-107806303 CTCCTCCAGGAAGCCTGTACAGG - Intronic
1015745700 6:136507290-136507312 GGCCTCCAGGAGTCCAGAGAGGG - Intronic
1015831542 6:137375372-137375394 GGCATCCAGGAGGGCTATGAAGG + Intergenic
1016010671 6:139135198-139135220 CGGCTCCAGGAAGCCGGAGAGGG + Exonic
1016620809 6:146107453-146107475 TGCCTGCAGGAAGCCTCTGAGGG - Intronic
1017385930 6:153883207-153883229 GGCACCCAGGATGGCTGTGAAGG - Intergenic
1017769141 6:157631641-157631663 GGCCTCCAAGATTCCTGGGAAGG + Intronic
1017928744 6:158934014-158934036 GGCCTCCACGAGGCCTGTGCTGG + Intergenic
1019174430 6:170153013-170153035 GGCCTCCAGCCAGCCGGTGGGGG - Intergenic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1019351524 7:556288-556310 GGCCTCTGGGATGCCTCTGAGGG - Intronic
1019481923 7:1270820-1270842 GGGCTGCAGGATGCCTGGGAGGG - Intergenic
1020634515 7:10680289-10680311 GGGCCCCAGGAATCCTGAGAGGG - Intergenic
1022466428 7:30655702-30655724 CGCCCCCAGGAAGGCAGTGAAGG - Exonic
1023232704 7:38051201-38051223 GGCCTCCAGGCAGCTTGTTAAGG + Intergenic
1023292268 7:38680703-38680725 GGGATTCAGGAAGCCTGAGATGG - Intergenic
1023401249 7:39793956-39793978 GGCCTCCCGGCAGCCTCTGCAGG + Intergenic
1023792998 7:43768777-43768799 GGCCTCCAGGTAGCCAGGGGAGG + Intronic
1024281296 7:47721851-47721873 TGCTTCCAGAAAGGCTGTGATGG + Intronic
1024472768 7:49780482-49780504 GGTCTCCTGGAGGACTGTGATGG + Intronic
1024648364 7:51386725-51386747 GGCCTCCCGGCAGCCTCTGCAGG - Intergenic
1024648896 7:51388798-51388820 GGCCTCCCGGCAGCCTCTGCAGG - Intergenic
1025042854 7:55662906-55662928 GGCCTCCAGGTAGTGTGTGCTGG - Intergenic
1025068043 7:55874676-55874698 GGCCCCCAGGTGGCATGTGAGGG + Intergenic
1025177594 7:56809915-56809937 GGCCTCCCGGCAGCCTCTGCTGG - Intergenic
1028349808 7:89832224-89832246 GGCCTCCAAGAAGGAAGTGAAGG + Intergenic
1029402303 7:100353725-100353747 GGCACCCAGGAGGCCTGGGAAGG - Intronic
1029653007 7:101906533-101906555 GGCCCCCAGGAAGCCACAGAAGG + Intronic
1030102239 7:105956621-105956643 GGGCTCCAGGAAGCCAATGAAGG + Intronic
1030103017 7:105962698-105962720 GCCCTCGAAGAAGGCTGTGAAGG - Intronic
1031542006 7:123005977-123005999 GGGGTTGAGGAAGCCTGTGAAGG - Intergenic
1033579106 7:142715558-142715580 GGCTTCCAGGGGGCCTGTAAAGG - Intergenic
1033664919 7:143431310-143431332 GGCCACCAGGAGGACTGTAAAGG - Intergenic
1035704089 8:1661609-1661631 GGCCACCAGGAAGCAGATGATGG + Intronic
1037696446 8:21228191-21228213 TGCCCCTAGGAAGCCTGTGCTGG - Intergenic
1039495683 8:37978385-37978407 TGGTTCCAGGAAGCCTGTGGTGG - Intergenic
1039884784 8:41648677-41648699 GGTCTCCAGGAAACCAGGGAGGG + Intronic
1040360433 8:46659253-46659275 GGCCCCCAGGTGGCATGTGAGGG - Intergenic
1041169886 8:55130639-55130661 GGCATCTAGGAACACTGTGAAGG - Intronic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1042685740 8:71438604-71438626 TGCCTTCATGAAGCATGTGAGGG + Intronic
1043176663 8:77029999-77030021 GGAATCCAGGAAGTGTGTGAAGG - Intergenic
1047254856 8:123207253-123207275 CGCCTCCTCCAAGCCTGTGATGG + Exonic
1048255301 8:132901002-132901024 TCCCTCCAGGAAGCCTCTGCTGG + Intronic
1048848868 8:138625260-138625282 GGCATCCTGGTAGCCTGGGAAGG + Intronic
1049199297 8:141332043-141332065 GGTCACCAGGAAGCAGGTGAAGG - Intergenic
1049203447 8:141352596-141352618 GGCCTCCAGGAAGCTGGGGCAGG + Intergenic
1049719964 8:144111235-144111257 GGCCTCCAGGAGGGCTGAGCAGG - Intronic
1051372635 9:16371370-16371392 GCCCTCCATGAAGCCTCTGAGGG - Intergenic
1051626179 9:19102136-19102158 GGACTCAAGGGAGCCTTTGAAGG - Intronic
1053165817 9:35842797-35842819 CTCCTCCAGGAAGCCTGTCCAGG + Intronic
1055090973 9:72364761-72364783 GGCCTCCGGGAAGGCTGAGCCGG + Intronic
1057063425 9:92026275-92026297 GGCCTCCAGGAGCCCTGAGAGGG + Intergenic
1057919235 9:99082914-99082936 GGGCTGCAGGAAGCCTGGTAGGG + Intergenic
1059344796 9:113620848-113620870 GGAGTCCAGGAAGCCTGAGACGG - Intergenic
1059941052 9:119360343-119360365 GACCTACAGGAAGCCTGGGCTGG - Intronic
1060389575 9:123267553-123267575 GGGCTCCAGGAGACCTGCGAGGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061423509 9:130484993-130485015 GGCAGCCAGGAAGCCGGTGCTGG + Intronic
1061816351 9:133199725-133199747 GGCCTCCCGGGAGCCAGGGACGG + Intergenic
1062036538 9:134385066-134385088 GGCCTCAAGGAAGGCTGCGCAGG - Intronic
1062301301 9:135872345-135872367 GACTTGCAGGCAGCCTGTGACGG + Intronic
1062320145 9:135986725-135986747 GGCCTCCATCAAGCCTGGGTTGG - Intergenic
1186093437 X:6074355-6074377 GCCCTCCGGGAAGCCTGAGGTGG + Intronic
1191254125 X:58272535-58272557 GGACTCCACGAACCCCGTGATGG + Intergenic
1194766118 X:97846519-97846541 GGCCTCAATCCAGCCTGTGAAGG - Intergenic
1195647490 X:107249351-107249373 CGCCTTCAGGAGTCCTGTGAAGG - Intergenic
1196009363 X:110870744-110870766 GGCCTCCAGCTGCCCTGTGAGGG - Intergenic
1196442151 X:115727698-115727720 GGACTCCAGCAGGCCTGGGAAGG + Intergenic
1196442811 X:115730652-115730674 GGACTCCAGCAGGCCTGGGAAGG + Intergenic
1196443411 X:115733216-115733238 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196444111 X:115736721-115736743 GGACTCCAGCAGGCCTGGGAAGG + Intergenic
1196445735 X:115845136-115845158 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196446406 X:115848117-115848139 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196447077 X:115851098-115851120 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196447746 X:115854081-115854103 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196448415 X:115857060-115857082 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196449085 X:115860051-115860073 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196449756 X:115863042-115863064 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196450425 X:115866025-115866047 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196451095 X:115869010-115869032 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196451766 X:115871989-115872011 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196452437 X:115874976-115874998 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196453107 X:115877945-115877967 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196453777 X:115880938-115880960 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196454445 X:115883947-115883969 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1196455521 X:115889009-115889031 GGACTCCAGCAGGCCTGGGAAGG - Intergenic
1199746053 X:150772476-150772498 GGCCTCTGGGAAGCCTATGGAGG + Intronic
1199773331 X:150989252-150989274 GGTCTCCTGGATGCCAGTGAGGG + Exonic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic
1201504756 Y:14685905-14685927 GCCCTCCAGGAAGCCTGAGGTGG - Intronic
1202381035 Y:24276698-24276720 GGCCTCCTGGTAGCCTCTGAAGG + Intergenic
1202489750 Y:25393428-25393450 GGCCTCCTGGTAGCCTCTGAAGG - Intergenic