ID: 1086938116

View in Genome Browser
Species Human (GRCh38)
Location 11:92766387-92766409
Sequence TGGCACTGCCTGGATAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086938106_1086938116 17 Left 1086938106 11:92766347-92766369 CCAGGAGAGAGTCGGTCTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1086938116 11:92766387-92766409 TGGCACTGCCTGGATAGGATGGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086938116 Original CRISPR TGGCACTGCCTGGATAGGAT GGG Intronic
900476296 1:2877936-2877958 GGGCACTGCCTGGGCAGGAATGG + Intergenic
900562738 1:3315607-3315629 TGGCACAGCCTGGAGAGGAGGGG + Intronic
901177695 1:7316768-7316790 TGGCCGTGCCCAGATAGGATGGG + Intronic
904266255 1:29319970-29319992 TGTCACTGCCTGGAGAGCCTGGG + Intronic
905896933 1:41554037-41554059 TGGCCCTGCCTTGCTAGGTTGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
911475909 1:98372064-98372086 GGGCACTGCCTGTATATAATTGG - Intergenic
913552474 1:119929131-119929153 GGTCAGTGCATGGATAGGATTGG - Exonic
917083459 1:171281046-171281068 TGGTACTGCCTGGCTTGTATAGG - Intronic
917920665 1:179747030-179747052 TGTCAGCGACTGGATAGGATTGG + Intronic
920980152 1:210826846-210826868 TTGCACAGCCTGGATAGGAGGGG - Intronic
923134851 1:231108814-231108836 TGGCACTGAATGGAGAGGAAGGG - Intergenic
1066766348 10:38806394-38806416 TGGAATTGGCTGGATAGGAATGG - Intergenic
1066769113 10:38829547-38829569 TGGAATTGGCTGGATAGGAATGG + Intergenic
1066939252 10:41868689-41868711 TGGCACGGAATGGATAGGAATGG + Intergenic
1066940022 10:41873594-41873616 TGGCACGGAATGGATAGGAATGG + Intergenic
1067931177 10:50563785-50563807 TGGGACTGATTGCATAGGATGGG - Intronic
1069342158 10:67423762-67423784 TGGCACTGCCTGTATAGGTGGGG - Intronic
1072705925 10:97680939-97680961 TTTCACTTCCTGGATATGATGGG - Intronic
1073041456 10:100609802-100609824 TGGCACTGCTTGGATGGGCATGG + Intergenic
1075019893 10:118944091-118944113 GGGGACTGCCTGGAGAGGAGGGG - Intergenic
1076340850 10:129743956-129743978 TGGCCATGCCTGGCTGGGATGGG + Intronic
1076868241 10:133179891-133179913 TGGCCCTGCCTGGCTGGGCTTGG - Intronic
1077341355 11:2027787-2027809 GGGCACCGCCTGGAGAGGACAGG - Intergenic
1080702290 11:34654207-34654229 TGCCCCTGCCTGGACTGGATAGG + Intronic
1084602795 11:70156150-70156172 TGGCACTGCATGGCTATGGTGGG + Intronic
1084608142 11:70184401-70184423 TGGCTCTTCGTGGATATGATTGG - Intronic
1084734306 11:71094456-71094478 GGGCACTGCGGGGATGGGATGGG + Intronic
1086518074 11:87637245-87637267 TGGCTCTGTATGGATAAGATAGG + Intergenic
1086938116 11:92766387-92766409 TGGCACTGCCTGGATAGGATGGG + Intronic
1087653888 11:100900447-100900469 TGGCCCTGCCTTGCTAGGTTGGG + Intronic
1090546578 11:127773137-127773159 TAGCTCTGCCTGGGGAGGATGGG + Intergenic
1202824340 11_KI270721v1_random:82976-82998 GGGCACCGCCTGGAGAGGACAGG - Intergenic
1104753218 12:131252926-131252948 AGTCACAGCCTGGATAGGAAGGG - Intergenic
1105894857 13:24709260-24709282 GGGCACTGGCTGGATGGGGTGGG - Intronic
1106394693 13:29368316-29368338 TTGCACTTCCTGGAGAGGATGGG - Intronic
1106431923 13:29688942-29688964 TGGCCCTGCCTGGATAATCTAGG - Intergenic
1107459281 13:40585808-40585830 TGGCACAGACTAGCTAGGATAGG - Intronic
1112246398 13:97738020-97738042 AGGCACTGCCTGCATTGTATAGG + Intergenic
1113044993 13:106146162-106146184 TGGCTCTTCCTGGATTGGAGTGG + Intergenic
1113459172 13:110469874-110469896 TGGCACTGCCTTGATTGCAGGGG + Intronic
1115034647 14:28842431-28842453 TGGGACTTCCTGGATTGGATGGG + Intergenic
1115647087 14:35376170-35376192 AGGGACTGCCTGGATAGGAGAGG - Intergenic
1115967255 14:38904808-38904830 TGGCACTGCTGGTGTAGGATGGG - Intergenic
1122786679 14:104167235-104167257 TGGGACTGCCGGGATGGGAGGGG + Intronic
1124433199 15:29625003-29625025 TGGGTGAGCCTGGATAGGATGGG - Intergenic
1125039201 15:35163610-35163632 GGGCACTGACTGGATATAATTGG + Intergenic
1127817253 15:62622020-62622042 TGGCACTGCCGGGGAAGGATGGG - Intronic
1131115076 15:89790493-89790515 TGTCACTGCCTGGATGAGGTTGG + Exonic
1131766723 15:95684306-95684328 TGGCACTGCATTGAATGGATTGG - Intergenic
1132035484 15:98480363-98480385 TGGCACTGCCTGGAAATCAAAGG + Intronic
1135223567 16:20636195-20636217 TGGCCCTCCCAGGATAGGAATGG - Intronic
1135984021 16:27170396-27170418 TGGCACTGTCTGGAGAGCCTTGG + Intergenic
1139192648 16:64882336-64882358 CTGCACTGCATGGATAGCATAGG + Intergenic
1140624561 16:76776252-76776274 TGCCACTGCAGGCATAGGATAGG + Intergenic
1145046239 17:19619086-19619108 TGCCACTAGCTGGAAAGGATAGG - Intergenic
1145834373 17:27943163-27943185 TGCCCCTGGCTGGATAGGAGTGG + Intergenic
1146061371 17:29609146-29609168 TGGCACTGGCTGGGCAGGACCGG + Exonic
1147968634 17:44207638-44207660 GGGCACTGCCTGGAATGGTTGGG - Intronic
1203209457 17_KI270730v1_random:66410-66432 TGGCATGGCATGGATAGGAATGG + Intergenic
1153361709 18:4205337-4205359 TGGCACTAAGTGGATGGGATAGG + Intronic
1156687408 18:39666668-39666690 TGGCACTGGCAGGATTGGAGAGG - Intergenic
1156707327 18:39899279-39899301 TGGGACTGTCTGGAAAGGAAAGG + Intergenic
1158538968 18:58335334-58335356 TGGCTTTGTCTGGATAGGGTGGG + Intronic
1161519734 19:4717123-4717145 TGGCCCTGCCTGGATGGAGTAGG - Intronic
1162487270 19:10968879-10968901 TGGCACAGCCTGGACTGGCTGGG + Intronic
1166046991 19:40235608-40235630 TGGCAGAGCCAGGATAGGAACGG - Intronic
1166258369 19:41621222-41621244 TGGCAAAGCCTGGACAGGCTGGG - Intronic
925237093 2:2289193-2289215 TGGCCCTGTCTGGCTAGGGTGGG + Intronic
934773251 2:96921374-96921396 TGGCACTGCCTGGAGGTCATCGG - Intronic
937151931 2:119692051-119692073 AGGCACTGACGGGACAGGATGGG - Intergenic
937445091 2:121950642-121950664 AGCCACTGCCTGGTCAGGATTGG + Intergenic
939018978 2:136936516-136936538 TGCCACAACCTGGATGGGATTGG + Intronic
947511560 2:230759239-230759261 TGTGACTGCCTGAATAAGATGGG + Intronic
1168729851 20:66850-66872 TGGAATTGACTGGAGAGGATTGG - Intergenic
1173196330 20:40916064-40916086 TGGAATTGCCAGGATAGGAAAGG + Intergenic
1173548429 20:43915970-43915992 TGGCCCAGCCTGGATGGGTTGGG + Intronic
1177889006 21:26782171-26782193 TGGAACTGCATGGATAGGACAGG - Intergenic
1179062754 21:37994906-37994928 GGGCACTGTCTGGGAAGGATGGG + Intronic
1179284611 21:39966770-39966792 TGCCACAGCCTGGGTGGGATTGG + Intergenic
1182262505 22:29084535-29084557 GGGCCCTGCCTGGGTAGGAGTGG + Intronic
1182445266 22:30386338-30386360 TGGGACTGCCCTGATAGGACCGG - Intronic
1183061026 22:35336508-35336530 TGGCATTGAGTGGATAGGACTGG - Intronic
1184980427 22:48091581-48091603 TGGGCCTGCCTGGGTAAGATCGG + Intergenic
951980482 3:28560930-28560952 TTGCACTACCTGGAAAGTATGGG + Intergenic
954332032 3:49896239-49896261 TGGCACTGGGTGGATGGGGTGGG + Exonic
966679980 3:182631602-182631624 TGGCAAGGCCTGGCCAGGATGGG + Intergenic
966850296 3:184160785-184160807 TGGCACAGCCTGCTTTGGATAGG - Intronic
970911767 4:21285012-21285034 TGGCACTGCCTGAAAAAGGTGGG - Intronic
971696323 4:29908311-29908333 TGGCACTGCCTAAATATGTTAGG - Intergenic
983048063 4:163010800-163010822 AGTCACTTCCTGGATACGATGGG + Intergenic
987292210 5:16519960-16519982 TGGCACGGACTGGACAGGAAAGG - Intronic
988494051 5:31729509-31729531 TCACACTGCCTGTATAGGGTGGG + Intronic
991940375 5:71846031-71846053 TTACACAACCTGGATAGGATTGG - Intergenic
992208264 5:74452241-74452263 TGACACTGCCTGGCTGGGAGGGG - Intergenic
992776612 5:80094567-80094589 CACCACTGCCTGGAGAGGATAGG + Intergenic
992984534 5:82214602-82214624 TAGCACTACCTGTATATGATTGG + Intronic
993764167 5:91834683-91834705 TGGCACTGGCTGTGTAGCATTGG - Intergenic
994901455 5:105776844-105776866 TGGAACAGCTTGAATAGGATTGG + Intergenic
996218011 5:120892313-120892335 TGACAATGCCTGGACAGGATAGG + Intergenic
997233884 5:132261518-132261540 GGGCACTGGCTGGAGAGGCTGGG + Intronic
1001596762 5:172903421-172903443 TTGCACTGCCTGGATGGGATGGG - Intronic
1006422623 6:33944912-33944934 TCACACTGTTTGGATAGGATTGG - Intergenic
1006875555 6:37292351-37292373 TCGCAAAACCTGGATAGGATAGG - Intronic
1007202135 6:40118561-40118583 TGTCACTGCCAGGATAGACTTGG - Intergenic
1015364070 6:132377055-132377077 GGCCACTGCTGGGATAGGATGGG + Intronic
1017847273 6:158270101-158270123 TTATACTGCCTGGATAGGAAAGG - Intronic
1018431240 6:163724415-163724437 TGCCCCTGCCTGGAGGGGATGGG + Intergenic
1018695842 6:166390859-166390881 TTCCACTGGCTGGATAGGTTAGG - Intergenic
1018941963 6:168314362-168314384 TCCCACTGCCTGGAGAGGCTTGG - Intronic
1020585372 7:10059302-10059324 TGGCAGTAACTGGATAAGATGGG - Intergenic
1022515843 7:30974592-30974614 AGGGACTGCCCGGCTAGGATGGG + Intronic
1024190172 7:46998328-46998350 AGGCAGAGCCTGGATATGATAGG + Intergenic
1024475236 7:49802164-49802186 TGGCTCTGGCTGGACAGGAGAGG + Intronic
1025639115 7:63350656-63350678 TGGCATTGCATGTACAGGATGGG - Intergenic
1025643584 7:63397436-63397458 TGGCATTGCATGTACAGGATGGG + Intergenic
1026969042 7:74456831-74456853 TAGCCCTGCCTGGCTAGGGTAGG + Intronic
1029559314 7:101291965-101291987 TGGCTCTGCCTGGAAAGCATAGG - Intergenic
1030013282 7:105192357-105192379 TGGAGCAACCTGGATAGGATTGG - Intronic
1037201955 8:16265510-16265532 TGGCAGAGCCTGAATAGAATTGG - Intronic
1037800712 8:22033829-22033851 TGGCTCTGGCTGGGTAGGAGGGG - Intronic
1039784820 8:40824981-40825003 TGGCACTGGCTGTTTAGAATCGG - Intronic
1040893248 8:52339131-52339153 TGCCACAGCCTGGATGGGCTTGG - Intronic
1043837635 8:85064605-85064627 TGGCTCGGCCTGGAGAGGAGGGG - Intergenic
1046121141 8:109848631-109848653 TGGCCCTGACTGGAGAGGGTGGG + Intergenic
1047799132 8:128290506-128290528 TAGCACTGGTTGGATAGGAAGGG + Intergenic
1053057929 9:35005121-35005143 TGGCTCTGCCTGGTGAGGAGGGG - Intergenic
1057140347 9:92722936-92722958 TGTGACTGCCTGGAGAGGAGAGG + Intronic
1059822503 9:117989609-117989631 TGGCAAGGCCTGAATAGGTTGGG - Intergenic
1060518218 9:124279080-124279102 TGGCCTGGCCTGGAGAGGATGGG + Intronic
1062054620 9:134464374-134464396 TGGGGCTTCCTGGATAGGAAGGG + Intergenic
1187286718 X:17912371-17912393 TGACACTGCCTGGATGGCACAGG - Intergenic
1189234197 X:39475261-39475283 TGCCATTGCCTGGCTAGAATTGG + Intergenic
1192115853 X:68410337-68410359 TGGCACTGCCTCCATAGGGGAGG + Intronic
1193425545 X:81337377-81337399 GGGCCCTGCCTGGTGAGGATTGG + Intergenic