ID: 1086944890

View in Genome Browser
Species Human (GRCh38)
Location 11:92835200-92835222
Sequence CTCCTATTCTTGGGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086944890_1086944894 -9 Left 1086944890 11:92835200-92835222 CCATTTGTCCCCAAGAATAGGAG 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1086944894 11:92835214-92835236 GAATAGGAGCCATCTTTCTATGG 0: 1
1: 0
2: 0
3: 5
4: 118
1086944890_1086944897 16 Left 1086944890 11:92835200-92835222 CCATTTGTCCCCAAGAATAGGAG 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1086944897 11:92835239-92835261 CCTTCTGTAATTTGTATATTAGG 0: 1
1: 0
2: 1
3: 30
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086944890 Original CRISPR CTCCTATTCTTGGGGACAAA TGG (reversed) Intronic
900209452 1:1446714-1446736 CTCCTATTTTTTGGTACAGACGG + Intergenic
900219271 1:1498576-1498598 CTCCTATTTTTTGGTACAGACGG + Intergenic
901412299 1:9092983-9093005 CTCCTATACATGAGTACAAAGGG - Intergenic
902511651 1:16969954-16969976 CTCACAGTCTTGGGGACAGAGGG - Intronic
907721297 1:56974752-56974774 CGCATATTCTTTGGGAGAAAGGG - Intergenic
907922711 1:58928562-58928584 CTTCTAGTCTTGGGGAAAAGGGG - Intergenic
908098691 1:60768013-60768035 CTCCTTTTCTGGGGGAAAGAAGG + Intergenic
910009460 1:82443235-82443257 CCTGTATTCTTGGGGACAAGTGG - Intergenic
910326881 1:86019471-86019493 CTCCAACTCTTGGGGTCAAGTGG - Intronic
912122558 1:106490393-106490415 CCTCTATTCTTGGGTTCAAATGG - Intergenic
912626400 1:111208068-111208090 GGCCTATTCTTGGGGAAATATGG - Intronic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
917257165 1:173128195-173128217 ATCCTATGCTTTGGGAGAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919134920 1:193495847-193495869 TTCCTAGTCTTTGGGACAATTGG - Intergenic
919299093 1:195738385-195738407 CCCCAATTCTTTAGGACAAATGG - Intergenic
922461262 1:225815954-225815976 CTCCTATTCCAGGGGATAATAGG - Intronic
922551668 1:226498705-226498727 GTCCTCTTCTTGGGGACAGAGGG - Intergenic
922917864 1:229272837-229272859 GCCCTGTTCTTGGTGACAAAGGG + Intronic
923647277 1:235836694-235836716 CTTGCATTCTTGGGGAGAAATGG - Intronic
923760847 1:236842736-236842758 TTTATATTCTTAGGGACAAAGGG + Intronic
923869536 1:237976027-237976049 CCCTTATTCCTGGGAACAAATGG - Intergenic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1064990124 10:21249303-21249325 CTCCCATTCTGTGGGTCAAATGG - Intergenic
1066667716 10:37802372-37802394 CTCCTGTTCTTAGGGTTAAAGGG - Intronic
1067575963 10:47408884-47408906 CTTCTGTTCCTGGGAACAAAAGG + Intergenic
1067767429 10:49097481-49097503 GTCTTAGACTTGGGGACAAAGGG + Intronic
1071479332 10:86052900-86052922 CTACAATTGCTGGGGACAAAGGG - Intronic
1074212604 10:111350925-111350947 TTCCCATTGTTGGAGACAAATGG - Intergenic
1078992692 11:16665443-16665465 CTCCTCTGCTTGTGGACTAAGGG + Intronic
1079563742 11:21854601-21854623 CTCCTATTGGTGGGGCCAGAGGG + Intergenic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1083865949 11:65453043-65453065 TGCCCATTCTTGGAGACAAAGGG - Intergenic
1084963208 11:72728189-72728211 CTCATATTATTGGCAACAAATGG - Intronic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088790616 11:113223079-113223101 TTCATATTTTTGGGGAAAAAAGG + Intronic
1090118202 11:123997107-123997129 CTCTTATTTAGGGGGACAAACGG - Intergenic
1094412119 12:30177670-30177692 CTCACATTGTTGGGGGCAAAAGG + Intergenic
1095148555 12:38762509-38762531 CTCATATTCTTAGGGACCTATGG - Intronic
1105404095 13:20119162-20119184 CTTCCATTCTTGGGTGCAAAGGG + Intergenic
1106400547 13:29425816-29425838 CTTCTCTTCTTGGGCACAGAGGG - Intronic
1106461922 13:29978362-29978384 CTCCTATTCTTGGGCACTTGGGG - Intergenic
1106949292 13:34864917-34864939 AACCTGTACTTGGGGACAAAGGG - Intergenic
1115383212 14:32764157-32764179 CTCATATTCCTGGGGACAGTGGG - Intronic
1118254266 14:64191556-64191578 CTCCTATGCTTGGGGCCAGTGGG - Intronic
1119066861 14:71537283-71537305 CTCCACTTCTTGGGTTCAAATGG + Intronic
1119078749 14:71672178-71672200 CTCCTATTCATTAGGCCAAAAGG - Intronic
1120758875 14:88268588-88268610 TTCCTATTTTTTGGGATAAAAGG - Intronic
1120803407 14:88718583-88718605 CTCCTAGTTTTAGGGACATAGGG + Intronic
1124707598 15:31978382-31978404 CTCCTTGTCCTGGGGACACAGGG + Intergenic
1125249731 15:37686442-37686464 CTAGTTCTCTTGGGGACAAAGGG - Intergenic
1125721326 15:41846517-41846539 CTCCTTGTCTTGGGGACCCAGGG + Intronic
1127990593 15:64113012-64113034 CTCCTAGTCTTGGTCACACAAGG - Intronic
1128225266 15:65997070-65997092 CTCCCCTGCCTGGGGACAAATGG - Intronic
1129809325 15:78494967-78494989 CTCCTATTTAGGGGGAAAAAAGG - Intronic
1130602464 15:85285668-85285690 GTCTTATTCTTAGTGACAAAAGG + Intergenic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1130885844 15:88091823-88091845 CTCATAATCTTGGGGACACTAGG - Intronic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1131131840 15:89905360-89905382 CTCCTATCCTTTGAGACAGAAGG - Intronic
1135669752 16:24365332-24365354 CTCCTACTCTTGGGGACAAGTGG + Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1138758171 16:59514118-59514140 GTCCTATTCTGGGGGAAAAATGG - Intergenic
1139041588 16:63005128-63005150 CTCCTATTCCTAGGGAAACAGGG - Intergenic
1139249193 16:65478506-65478528 CTCCAATGCCTGGGGCCAAAGGG + Intergenic
1139810519 16:69612624-69612646 CTCCAATTCTTGGGCTCAAGTGG - Intronic
1145960092 17:28882229-28882251 CTCAGCTTCCTGGGGACAAAAGG + Exonic
1145997611 17:29113584-29113606 GTCCTCTACTTGGGGACAATGGG + Intronic
1146624034 17:34422529-34422551 CTCTTCTTCCTGGGGACAGAGGG - Intergenic
1147704913 17:42420000-42420022 ACCCTATTCCTGGGGAGAAAAGG - Intronic
1147728737 17:42583370-42583392 CTCCTTGTCTTGGGAACAAGGGG + Intronic
1150620658 17:66805695-66805717 CTCTTCCTCTTGGGGACAACAGG + Exonic
1152299405 17:79486282-79486304 CCCCACTTCCTGGGGACAAAAGG + Intronic
1156739724 18:40309569-40309591 TTCCTCTTCTTGGGGTTAAAGGG + Intergenic
1159141784 18:64405194-64405216 CTCTTATTCTCAGGTACAAATGG + Intergenic
1159940774 18:74406185-74406207 GGCTTATTCTTGGGGACTAAGGG - Intergenic
1160316367 18:77851489-77851511 CTCCTATTCATGTGGAAGAAAGG - Intergenic
1161872891 19:6884307-6884329 CTAGTATTCTTGGGGCCAACGGG + Intergenic
1165520727 19:36311923-36311945 CTCCTACTCTAGGGGACACAGGG - Intergenic
1165623345 19:37266662-37266684 CTCCTACTCTAGGGGACACAGGG + Intergenic
1165635148 19:37334176-37334198 CTCCTACTCTAGGGGACAAAGGG + Intronic
1167291459 19:48627465-48627487 CTCCCACACATGGGGACAAAGGG + Intronic
1167762499 19:51458341-51458363 CCCCTGCTCTGGGGGACAAAGGG - Exonic
925725885 2:6870648-6870670 CTCCTAAACTTGGGGTCAAGAGG - Intronic
925776899 2:7344503-7344525 CTCCCCTTCTTGGGGCAAAAGGG - Intergenic
926755955 2:16236108-16236130 CTCCCATTCTTGGGGGTAGATGG + Intergenic
927186825 2:20488037-20488059 CTCCTCTTCATGGGGACAGCAGG + Intergenic
928870607 2:35973360-35973382 CTACCATTCCTGGGAACAAAAGG - Intergenic
931700684 2:64906544-64906566 CTCCTATGCTTTGGGAGAGATGG + Intergenic
933192553 2:79351661-79351683 CTCCTATTCTTGAGAACAGGTGG + Intronic
934104823 2:88685963-88685985 CCCCAATTCTTTGGGAAAAATGG - Intergenic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935810593 2:106793459-106793481 CTACTCTGCTTGGGGAGAAAGGG + Intergenic
939925610 2:148170204-148170226 CTTCTTTTCTTTGCGACAAAAGG + Intronic
941059059 2:160825385-160825407 CTCCAAGTCTTGGGGAAATATGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
944155632 2:196604332-196604354 CTACTATTCATAGGCACAAAGGG - Intergenic
948283046 2:236763065-236763087 CTCATACTCTTGGGGCCAGAAGG - Intergenic
1170127537 20:12981877-12981899 CTCGAAATCTTGGGGAGAAATGG - Intergenic
1173022013 20:39274725-39274747 TTCCCAGTCTGGGGGACAAAAGG - Intergenic
1174635914 20:51999259-51999281 TTCCTTTTGTGGGGGACAAATGG + Intergenic
1180628011 22:17207433-17207455 CTCCGGGGCTTGGGGACAAAGGG + Intronic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1185144412 22:49123142-49123164 CGCCTATTTGTGGGGGCAAATGG + Intergenic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
950609080 3:14113475-14113497 CTCCTCTTCTTTGGGCTAAATGG - Intronic
955953272 3:64263404-64263426 CTCCTAGTCTTTGGGGCACATGG - Intronic
956507044 3:69952644-69952666 CGCATATTCCTGGGGACTAAAGG - Intronic
957828283 3:85479796-85479818 CTCCTAAACTTTGGGAGAAAAGG + Intronic
959110296 3:102115044-102115066 CTCCTCTCCTTTGGGACACATGG + Intronic
960910736 3:122646676-122646698 CTGCTATTCTGGGAGCCAAATGG - Intergenic
962697245 3:137962426-137962448 CACCAGTCCTTGGGGACAAAAGG + Intergenic
963528954 3:146449171-146449193 CTGCTAATCTTGGTGACAGATGG - Intronic
964313435 3:155418504-155418526 CTCCCATTCCTGGGGAAAATAGG - Intronic
966143589 3:176785258-176785280 CTCCTATCCTTGGAGAGAAATGG - Intergenic
969370869 4:6730961-6730983 CTCCAGTTCTTGGGGCCCAAAGG + Intergenic
970177160 4:13350871-13350893 ATCCTATTTTTGGAGACAGAAGG - Intergenic
978619512 4:110624406-110624428 GACCTATGCTGGGGGACAAAAGG - Intronic
979343856 4:119562037-119562059 AACCTATTCTTAGGGACTAAAGG + Intronic
980666868 4:135951847-135951869 CTCCAATTCTTGGGCTCAAGTGG - Intergenic
981155229 4:141427174-141427196 CTCCTATGCTTGGGCACTGATGG + Intergenic
983658418 4:170106997-170107019 CTCCAATTCTTTGGGGAAAATGG - Intergenic
984029102 4:174581366-174581388 CTCCTATTCTTGTATATAAAGGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985983827 5:3496455-3496477 CTATGATCCTTGGGGACAAAAGG + Intergenic
986322546 5:6644664-6644686 CTCCTGTTCTGGTTGACAAATGG + Intronic
986794040 5:11191843-11191865 CTGCCACTCATGGGGACAAATGG - Intronic
988464376 5:31474581-31474603 CTCCAATTCCTGGGATCAAATGG + Intronic
990874876 5:60473319-60473341 CTCCTATATTTTGGGACAACTGG + Intronic
991135524 5:63177474-63177496 CTACAATCCTTGGGGACAAATGG - Intergenic
992688624 5:79221861-79221883 CTCCTATTCTTTTCAACAAAGGG + Intronic
993447777 5:88035781-88035803 CTCCTATTGCTGGGCAGAAATGG - Intergenic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
1000294038 5:159897613-159897635 CGCCTAATCTTGAGGAGAAATGG - Intergenic
1004812041 6:19272516-19272538 TTCCTATAAGTGGGGACAAAAGG + Intergenic
1006052351 6:31354731-31354753 CTCCTAGTCTTGGACCCAAAAGG + Intronic
1007444275 6:41893795-41893817 TTCCTACTTTTAGGGACAAAAGG + Intronic
1010439283 6:75874774-75874796 AACCTATTCTTGGAGAGAAAAGG - Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014793368 6:125700786-125700808 CTCCCAGCCTTGGGAACAAAGGG - Intergenic
1015712021 6:136152444-136152466 CTCCTAAACTATGGGACAAATGG - Intronic
1017641761 6:156501149-156501171 ATCCTATTTATGGGGAAAAAAGG + Intergenic
1021028128 7:15694933-15694955 CTCCTAATCATGGGGTCAAAAGG - Intergenic
1022259934 7:28694626-28694648 CTCGAACTCTTGGGGTCAAATGG + Intronic
1022283174 7:28930874-28930896 CAGCTTTTCTTGGGGACAGATGG - Intergenic
1028122730 7:87074335-87074357 CTTGTATCCTTGTGGACAAATGG - Intergenic
1032531189 7:132621935-132621957 CTCCTATTTATGGGGAGAAGAGG - Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1034696125 7:153055542-153055564 TCCCTGCTCTTGGGGACAAACGG - Intergenic
1034900166 7:154903390-154903412 CTCGTTTTCTGGGAGACAAAGGG + Intergenic
1035609278 8:949243-949265 CTCCTTTTCCTGCCGACAAATGG - Intergenic
1035947338 8:3979918-3979940 TTCATATTATTGAGGACAAAGGG - Intronic
1037462543 8:19127209-19127231 TTACTATTCTGTGGGACAAAGGG - Intergenic
1037471599 8:19216161-19216183 CTCCCCTTCCTGGGGCCAAAGGG + Intergenic
1038052273 8:23825174-23825196 CTTCTATTCTGGGTGGCAAATGG - Intergenic
1038143584 8:24872644-24872666 CTCCTATCCTTGGCTACAACAGG + Intergenic
1045781667 8:105871846-105871868 CTCCTAATTTTGGGGAGTAAGGG + Intergenic
1046276881 8:111973278-111973300 CTCCCATTCTTCTGGACAAGAGG + Intergenic
1046821821 8:118642202-118642224 CATCTCTTCTTGGGAACAAAGGG - Intergenic
1048784541 8:138036626-138036648 ATCTTATTCTTGGGAACAAAGGG - Intergenic
1049843801 8:144790139-144790161 CTCCGTTTCTTGCGGAGAAACGG + Intronic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050783296 9:9367068-9367090 CTCATTTTCTGTGGGACAAAGGG - Intronic
1052823205 9:33155785-33155807 CTCATCTTCTTGGGCACAAAAGG - Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053438907 9:38097074-38097096 TTCCTATTCTTAGGATCAAAAGG - Intergenic
1053780563 9:41601984-41602006 CTCACAAGCTTGGGGACAAAAGG - Intergenic
1054168506 9:61812141-61812163 CTCACAAGCTTGGGGACAAAAGG - Intergenic
1054669023 9:67768677-67768699 CTCACAAGCTTGGGGACAAAAGG + Intergenic
1055658003 9:78471546-78471568 CTCCCATTCTTGATGGCAAATGG + Intergenic
1057319825 9:94002348-94002370 ATCCCATTCTTGGGGAAAAGGGG - Intergenic
1060680291 9:125556638-125556660 CTCCTCTACTGGGAGACAAATGG + Intronic
1061169462 9:128943850-128943872 CTCCCAAGCTTGGGGAGAAAGGG + Intronic
1061902063 9:133678068-133678090 CTCTCATCCTTGGGGACCAATGG - Intronic
1061974070 9:134059597-134059619 CTCCTTTTCTTGGGGAACAGGGG + Intronic
1186527020 X:10258064-10258086 CTGCCCTTCTTGGTGACAAAGGG + Intergenic
1194272759 X:91838691-91838713 ATCCTATTCTGCAGGACAAAGGG - Intronic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1200589999 Y:5060105-5060127 ATCCTATTCTGCAGGACAAAGGG - Intronic
1202168206 Y:22014692-22014714 TTCTTATCCTTGGGGTCAAATGG - Intergenic
1202223155 Y:22571676-22571698 TTCTTATCCTTGGGGTCAAATGG + Intergenic
1202319960 Y:23623984-23624006 TTCTTATCCTTGGGGTCAAATGG - Intergenic
1202550808 Y:26046072-26046094 TTCTTATCCTTGGGGTCAAATGG + Intergenic