ID: 1086945274

View in Genome Browser
Species Human (GRCh38)
Location 11:92838657-92838679
Sequence TGGCCTCAGAATCACCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086945271_1086945274 18 Left 1086945271 11:92838616-92838638 CCACAGGTATTCTAGAGAATTAG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1086945274 11:92838657-92838679 TGGCCTCAGAATCACCCCAAAGG 0: 1
1: 0
2: 2
3: 19
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086945274 Original CRISPR TGGCCTCAGAATCACCCCAA AGG Intronic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
902642000 1:17772780-17772802 TGGCCCCAGAAACACCCCTCTGG - Intronic
904037364 1:27566019-27566041 GGGCTCCAGAGTCACCCCAAAGG - Intronic
904674116 1:32187766-32187788 TGAACTCACAATAACCCCAAAGG - Intronic
906572584 1:46856801-46856823 TGGCAACAGAATCACCCAAGTGG + Intergenic
906599190 1:47109090-47109112 TGGCAACAGAATCACCCAAGTGG - Intronic
907108318 1:51904139-51904161 AATCCTCAGAATCACCCTAAGGG + Intergenic
907556432 1:55348519-55348541 TGGCCTCAGCATCATCCTGAGGG + Intergenic
907842787 1:58173055-58173077 TGGCCTCAGCATCTGCCCAGTGG - Intronic
908789360 1:67766635-67766657 TGGCTTCAGAATTTCCCCAGTGG - Intronic
909209486 1:72805874-72805896 TGGACTCAGACTTACCCCAGTGG + Intergenic
909359238 1:74742572-74742594 TAGCCTCAGCATCTGCCCAACGG + Intronic
914373489 1:147051361-147051383 TGGCCTAAGAAGCGCCCCCAGGG - Intergenic
915872863 1:159580248-159580270 CAGCTTCAGAATCACCCCGAAGG + Intergenic
915943834 1:160135817-160135839 TGCCCTCAGAATCTCCCCACAGG + Exonic
917280318 1:173373289-173373311 TGGCCTCAGCATCTGCCCGATGG - Intergenic
917810413 1:178653045-178653067 TGGCCCCAGAAGCACTCCAGGGG - Intergenic
920343115 1:205288122-205288144 TGGCCTCAGAAGCAGCTCAGAGG - Intergenic
920690556 1:208143301-208143323 TGTCCTCAGAATCACCTGGAGGG + Intronic
923917645 1:238527245-238527267 AGGCCTCAGAAGCACTTCAAAGG - Intergenic
924927325 1:248695864-248695886 TGTCCTCAGAATGACCTAAAAGG + Intergenic
1064245780 10:13666643-13666665 TGGGCTCTGAATCTCTCCAAAGG - Intronic
1065822654 10:29540208-29540230 GGGCCTTAGAACCACCGCAAGGG - Intronic
1066704904 10:38166713-38166735 TGGGCTCAGAACCAGCCTAAAGG + Intergenic
1068207837 10:53880235-53880257 TGGCCACAGATTCAACCCATGGG + Intronic
1071899264 10:90101474-90101496 TGGCCTCAGAATCACCCTTAGGG - Intergenic
1075855251 10:125624429-125624451 TGGGCTCTGAATCAGACCAAAGG + Intronic
1075945722 10:126431478-126431500 GGGCCACAGAAACATCCCAATGG + Intronic
1076606137 10:131691154-131691176 TGGCATCAGAATCACCTGAAGGG - Intergenic
1077282314 11:1751251-1751273 TGGCCTCAGAGGCAGCCCCAAGG - Intronic
1078556381 11:12330112-12330134 TGGCCTCAAAAGCAACCAAATGG + Intronic
1083142475 11:60733433-60733455 GTGCCCCAGAATCACCCCAGGGG - Intronic
1083654740 11:64224164-64224186 TGGAGTCAGAATCACCCCATTGG + Exonic
1083701160 11:64478501-64478523 TGGCCTCAGCCTCATCCCACTGG + Intergenic
1085341699 11:75735654-75735676 TGGCCTCAGACCCAGCCGAATGG + Intergenic
1085700271 11:78739742-78739764 TGCCTTCAAAATCACCCCAAGGG - Intronic
1086316026 11:85593339-85593361 ATGCCTCAGAATCACCTGAAAGG + Intronic
1086945274 11:92838657-92838679 TGGCCTCAGAATCACCCCAAAGG + Intronic
1088699964 11:112403005-112403027 TGTCCTGAGACTCACCCCAAGGG - Intergenic
1089042987 11:115471568-115471590 TGGTGTCAGAATGACCCCAAAGG + Intronic
1089497642 11:118915895-118915917 TGGCCCCAGAAGCCCCCAAAGGG + Intronic
1091495725 12:971181-971203 TTGCATCATAGTCACCCCAAGGG - Intronic
1096183522 12:49564338-49564360 AGGCCTCAGTATCACCCCCAAGG + Intronic
1097327194 12:58290143-58290165 GGGCATCAGAATCACCTGAAGGG - Intergenic
1097399081 12:59107933-59107955 TGGCAAAAGAAGCACCCCAAGGG - Intergenic
1098658676 12:73067002-73067024 TGGTCTCAGAATCCCCACATTGG + Intergenic
1100554674 12:95681299-95681321 TGTCCACAGAATAACCACAATGG - Intronic
1100946430 12:99788737-99788759 AGGCCTCAGACTCACCCTATAGG - Intronic
1102790422 12:115639745-115639767 AGGCCTCGGAAACCCCCCAAAGG - Intergenic
1103435705 12:120923777-120923799 TGGCCGCAGAGGAACCCCAAAGG - Intergenic
1104997425 12:132667288-132667310 AGGCCTCAGAAGGACCCTAAAGG - Intronic
1116412134 14:44637409-44637431 TGGCCCCAGAGTTTCCCCAAAGG + Intergenic
1118573480 14:67218454-67218476 AGGCCTCAGAAACAGCCCACAGG - Intronic
1119207014 14:72801987-72802009 TTGGCTCTGAGTCACCCCAAAGG - Intronic
1122084392 14:99289801-99289823 TGGCCTCAGACTCCCTCCTAAGG - Intergenic
1125589685 15:40846513-40846535 AGGCCTGAGATTCACCCCAGGGG + Intronic
1126175686 15:45733277-45733299 TGACCACAGGATCAGCCCAAGGG + Intergenic
1126251718 15:46575257-46575279 TAGCATCAGAAACACCCCAAGGG + Intergenic
1127854843 15:62945834-62945856 TGGCCTCAGGACACCCCCAAAGG + Intergenic
1128617014 15:69118145-69118167 AGGCGTCAGAATCACCCACAGGG - Intergenic
1128843356 15:70868532-70868554 ATGCATCAGAATCACCCAAAGGG + Intronic
1130254178 15:82318249-82318271 TGGCCTCAGAGGCACAACAAGGG + Intergenic
1130600793 15:85271722-85271744 TGGCCTCAGAGGCACAACAAGGG - Intergenic
1130762437 15:86834367-86834389 TGGTCTCAGAATCAGCTCTATGG + Intronic
1130974372 15:88762117-88762139 TGGCCTCAGGTTTACCCCCAAGG + Intergenic
1131891936 15:96982651-96982673 TGGCCTCAGACTCTGCACAAAGG - Intergenic
1132141343 15:99399218-99399240 TGGCCACAAAAACTCCCCAAAGG - Intergenic
1132728483 16:1349041-1349063 TGGCCTCAGAGTGACCTCAGGGG - Exonic
1137920267 16:52480150-52480172 TGGCCTCAGGATCAACCCCAGGG + Intronic
1141429366 16:83963343-83963365 TGGCCTCACAATATTCCCAAAGG + Intronic
1142010772 16:87712714-87712736 AGGCCTCAGAAATACCCGAAGGG - Intronic
1142114147 16:88347750-88347772 TTGGCTCAAATTCACCCCAAAGG + Intergenic
1144176369 17:12711813-12711835 TTGCATCAGAATCACCCAGAAGG + Intronic
1147384141 17:40071820-40071842 TCGCCTCTGTATCACCCCAAAGG + Intronic
1148234757 17:45961374-45961396 TGGGCTGAGAAGCACCCCACAGG - Intronic
1148371902 17:47106234-47106256 TGGCCTCAGAACCTCCAGAAAGG - Intergenic
1148538399 17:48459930-48459952 TGGCCTGGAAATCACCCCCATGG + Intergenic
1148707310 17:49646862-49646884 TGATCTAAGAGTCACCCCAAAGG - Intronic
1148861264 17:50605476-50605498 TTGCGTCAGAATCACCAGAACGG + Intronic
1151179689 17:72318096-72318118 AGGTCTCAGAATGACCCAAAAGG + Intergenic
1152879608 17:82807680-82807702 TGGCCGCAGAAGCACCCCGGGGG + Intronic
1153373500 18:4348725-4348747 TGGCATCAGAGTCACCCTGAAGG + Intronic
1153802063 18:8680039-8680061 ATGCATCAGAATCACCCCGAGGG - Intergenic
1157774774 18:50384027-50384049 TGGCCTCAGGAGCAAGCCAAGGG - Intronic
1159253717 18:65917156-65917178 TGTGCTCAGAATCACCCGGAGGG - Intergenic
1160054098 18:75463377-75463399 TGGCCTCATAAACACCCCAAGGG + Intergenic
1160055293 18:75473050-75473072 TGGCCTCAGGATCCCCACACAGG + Intergenic
1160402738 18:78622541-78622563 TGGACTAAGATTCACCCCATTGG + Intergenic
1161751203 19:6097971-6097993 TGGCCACAGAATCAAGCAAATGG - Intronic
1163238185 19:16041974-16041996 TGGCTCCAGAATCCCCCCCACGG + Intergenic
1163980765 19:20897774-20897796 TAGCCACACAATCACCGCAATGG + Intergenic
1167245855 19:48372922-48372944 AGTCCTCAGAACCACCCCAGAGG + Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
926478376 2:13357024-13357046 TGGCCTGAGACTCACCCCTGAGG - Intergenic
927158392 2:20235751-20235773 TGGTCTCAGAATCTCCTCCAAGG - Intergenic
927524098 2:23721452-23721474 TGGCCTAAGAAACAGCCCAATGG + Intergenic
929561223 2:42957733-42957755 TGCCCTCAGGATCGCCACAAGGG - Intergenic
930713483 2:54571346-54571368 AGGCTTTACAATCACCCCAAGGG - Intronic
932775168 2:74524187-74524209 TGGCATCAGATTCACTCCAGGGG - Exonic
932835189 2:75029487-75029509 TCCCCTCAAAATCTCCCCAAAGG + Intergenic
935988172 2:108694764-108694786 TGGTGGCAGAGTCACCCCAAAGG - Intergenic
938569112 2:132546179-132546201 GTGCCTCAGAATCACTCCCAGGG + Intronic
939852283 2:147316787-147316809 TGGCCTCAGCATCTGCCCGACGG - Intergenic
940363542 2:152820822-152820844 TGGCCACAGATTTCCCCCAATGG - Intergenic
940925887 2:159363243-159363265 TGGCAGGAAAATCACCCCAATGG - Intronic
941713002 2:168734322-168734344 TGCCCTCAGAATCTGCCCCAGGG - Intronic
947086822 2:226462205-226462227 TGGAAACAGAATCACCCAAAAGG + Intergenic
947645658 2:231737463-231737485 TGTCCTCTGAACCACACCAAAGG + Intronic
1169791458 20:9414486-9414508 AGTCCTCAGACTCAGCCCAAAGG - Intronic
1170802245 20:19600063-19600085 TTCCCTCAGAATGACCCCCACGG - Intronic
1172120646 20:32596814-32596836 AGGCCTCAGATCCACCCCCATGG - Intronic
1173947681 20:46964666-46964688 TGCCCTCAGAACAACCCCATTGG + Intronic
1174505350 20:51014182-51014204 TGGCCTCAGCATTTCCCCAGGGG - Intronic
1175326100 20:58129547-58129569 TCGGGTCAGAATCACCCCATTGG + Intergenic
1179165665 21:38933463-38933485 GGGCATCAGAATCACCTGAATGG + Intergenic
1179641832 21:42752837-42752859 TGTCCTCAGAAGCAACCCAGGGG + Intronic
1181397805 22:22634076-22634098 TGGCCTCTGCATCACCCTTAGGG + Intergenic
1181500550 22:23313446-23313468 TGGCCTCTGCATCACCCTTAGGG + Intronic
1181705771 22:24648757-24648779 TGGCCTCTGCATCACCCTTAGGG + Intergenic
1182350398 22:29696007-29696029 GGGCCACAGAACCACCCCCACGG + Exonic
1182804274 22:33057634-33057656 TAGCCCCAGAAGCTCCCCAAAGG + Intronic
1185181907 22:49368599-49368621 TGGCCTCTGCGTCTCCCCAAAGG + Intergenic
949760762 3:7467587-7467609 TGGCCTCAGAATGACTCCCTAGG - Intronic
949802039 3:7914745-7914767 GGGCATCAGAATCGCCCAAAAGG - Intergenic
950982325 3:17320399-17320421 TTGCATCAGAATCACCCAAAGGG - Intronic
951895900 3:27609522-27609544 TGGCCCCTCAATCTCCCCAATGG + Intergenic
952223940 3:31354317-31354339 TAAACTCAGAATCACCCTAAAGG + Intergenic
954587412 3:51747727-51747749 TGGCCTCAGCATCTGTCCAACGG - Intergenic
956871785 3:73425440-73425462 TGGCATCAGAATCACCAGGAGGG - Intronic
960005280 3:112775370-112775392 GGGAATCAGAATCACCCTAATGG + Intronic
960301452 3:116007831-116007853 TTGCATCAGAATCACCTGAAGGG + Intronic
960731320 3:120730970-120730992 TTGCATCAGAATCACCCGGAGGG + Intronic
962134046 3:132714346-132714368 TTGCCTTAGAATAACTCCAACGG + Intronic
962664551 3:137641074-137641096 GTGCATTAGAATCACCCCAAGGG - Intergenic
967439791 3:189493237-189493259 TGGGCTCACAATCACCTCCATGG - Intergenic
967712012 3:192720118-192720140 TAGCCTGAGAAGCAACCCAAAGG - Intronic
969106029 4:4807699-4807721 TGGCCCCAAATCCACCCCAAGGG - Intergenic
970873892 4:20847477-20847499 GAGCCTCAGAATCACCTGAAGGG - Intronic
971193237 4:24447451-24447473 TGGCCTGAGTTTCAGCCCAATGG - Intergenic
971511208 4:27426512-27426534 AGGCTTCAGAATCAACCCCAGGG + Intergenic
977249854 4:94677483-94677505 TGGCCTCAAAACTAACCCAACGG - Intergenic
980290481 4:130843809-130843831 TGGCCTCAGCATCTGCCCAACGG + Intergenic
983524067 4:168742354-168742376 TGGCCTCTGTATCAACCCAGAGG - Intronic
984340292 4:178448563-178448585 AGGCATCATAATCACCTCAAAGG - Intergenic
987587483 5:19874969-19874991 TTGCATCAGAATCACCCAGAAGG + Intronic
988360537 5:30231349-30231371 AGGCCTCACAATCACGGCAAAGG + Intergenic
990419291 5:55615832-55615854 TGGCCTCAGCATCTGCCCGATGG - Intergenic
992900053 5:81285827-81285849 TGGCCTCAGCATCAACACAATGG + Intergenic
996306466 5:122053424-122053446 TGTCCTGGGAAACACCCCAATGG - Intronic
996325125 5:122264432-122264454 TTGCCTCAGAAGCACCTGAAGGG + Intergenic
998403639 5:141861747-141861769 TGGCCTCAGAGACTCCCCCAGGG + Intronic
1003354544 6:5354839-5354861 TGGCATGAGAATCACCCTGAAGG + Intronic
1004531788 6:16461105-16461127 TGGCCTCAGCATCTGCCCAGTGG - Intronic
1006904877 6:37526496-37526518 TGGCATCAGAATCTCCTGAAGGG - Intergenic
1007030453 6:38621818-38621840 TGGCCTCAGCATCTGCCCGACGG - Intronic
1008490641 6:52083339-52083361 CTGCCTCAGAATCACCAGAAAGG + Intronic
1009902304 6:69822249-69822271 TGGCCTAACAACCTCCCCAAAGG - Intergenic
1014381079 6:120743218-120743240 TGCCCTCATAATCTCCCAAAAGG - Intergenic
1015815820 6:137209605-137209627 AGGCCTCAGAATCACAGCAAGGG - Intronic
1015889342 6:137954304-137954326 TGGCCTCAGAACCTCCAGAAAGG - Intergenic
1017101375 6:150852460-150852482 TGGCCTCAGTATCTGCCCAGTGG - Intergenic
1018257846 6:161940194-161940216 TGGCCTAAGAATAACTCCATTGG - Intronic
1018837625 6:167497082-167497104 TGGCCCCAGAACAACCCCCAGGG - Intergenic
1021387385 7:20048114-20048136 TTGCATAAGAATCACGCCAAGGG - Intergenic
1021941224 7:25680723-25680745 TAGCCTCAGGATGACCCCACTGG + Intergenic
1022216291 7:28265540-28265562 CTGCCTCAGAATCACCCTCAGGG + Intergenic
1022429588 7:30303406-30303428 GGGCCTGAGAATCACCCAGAGGG + Intronic
1023499298 7:40830825-40830847 TAGTCTCAGAATCAACCCCATGG - Intronic
1023684475 7:42720683-42720705 TGGCCTCAGAACAACCCCTCAGG + Intergenic
1025260757 7:57416052-57416074 AGGCCTCAGGGTGACCCCAAGGG + Intergenic
1026739941 7:72972801-72972823 GGGCCTCAGAACTACCCCTACGG + Intergenic
1027103792 7:75392269-75392291 GGGCCTCAGAACTACCCCTACGG - Intergenic
1027688248 7:81305818-81305840 TGGCCTCAAAATCAGCCCACTGG + Intergenic
1028494824 7:91450922-91450944 TGGCCTCAGCATCTGCCCGACGG + Intergenic
1031384775 7:121135458-121135480 TGGCCTCAGAATCATCTGAAGGG - Intronic
1033309720 7:140252114-140252136 ATGCCTCTGAAACACCCCAAAGG - Intergenic
1035132952 7:156672922-156672944 GGGCCTCAGAATCACCTGGAGGG + Intronic
1037037033 8:14180621-14180643 TGGACTAAGAATCTCCCTAAAGG + Intronic
1042772310 8:72393371-72393393 TGGCCTCAGCGTCTGCCCAACGG - Intergenic
1044992313 8:97807001-97807023 AGGCCTCAGAATCATGGCAAAGG - Intronic
1046870039 8:119196144-119196166 TTGCCTCACAATAACCTCAAAGG + Intronic
1048610678 8:136019529-136019551 TGGCCTCAGCAGCACCACATTGG + Intergenic
1049267483 8:141676591-141676613 TGGCTTCAGAACCACACCTATGG + Intergenic
1049499159 8:142952329-142952351 TGGCCCCTGAGTCACCCCAGCGG + Intergenic
1049827471 8:144678794-144678816 TGGTGTCAGAATCACCCCTGGGG + Intergenic
1051844062 9:21431867-21431889 TGGCCTGAGAAACAACCCCATGG + Intronic
1052057379 9:23920451-23920473 TGGCCTCAGCATCTGCCCAGCGG + Intergenic
1052815508 9:33099948-33099970 TGGCCTGAGGCTGACCCCAAGGG - Intergenic
1054747140 9:68865820-68865842 TGTGCTGAGAATCACCCCGACGG - Intronic
1056501955 9:87218248-87218270 TTGCCTCAGAATCACCAGAATGG - Intergenic
1059437316 9:114284524-114284546 TGGTCCCAGACACACCCCAAAGG - Intronic
1060908564 9:127330145-127330167 AGGCATCAGAATCACCTGAAGGG - Intronic
1061796195 9:133087149-133087171 GGGCCTCAGAGTCACCCGTAGGG - Intronic
1185633378 X:1534406-1534428 TGCCCCCAGGATCACCCCCAAGG - Intronic
1188587442 X:31795015-31795037 TGGGCCCAGTGTCACCCCAATGG + Intronic
1189314660 X:40046151-40046173 TTGCCTCAAAATCATCCCAGTGG - Intergenic
1192638143 X:72840319-72840341 TTGCATCAGAATCACCCAGAGGG - Intronic
1192643571 X:72880493-72880515 TTGCATCAGAATCACCCAGAGGG + Intronic
1193406621 X:81108697-81108719 TGTCCCCAGAAACACCCAAATGG - Intergenic
1193829110 X:86266119-86266141 ATGCCTCAGAATCCCCTCAAGGG + Intronic
1196661946 X:118279294-118279316 TGGCCTCAGCATCTGCCCAATGG + Intergenic
1197783536 X:130179015-130179037 TGGCCTCAGAACCATCAGAAAGG - Intronic
1198626279 X:138579181-138579203 TGGTCTCACAATCACGGCAAAGG - Intergenic
1200776586 Y:7175187-7175209 TGGCCTCAGCATCTGCCCGATGG - Intergenic