ID: 1086949036

View in Genome Browser
Species Human (GRCh38)
Location 11:92872340-92872362
Sequence CTCTCCTCACAGCTGGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086949030_1086949036 4 Left 1086949030 11:92872313-92872335 CCAATGGATGCCACTGGTGTGGC 0: 1
1: 1
2: 2
3: 9
4: 118
Right 1086949036 11:92872340-92872362 CTCTCCTCACAGCTGGTTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 142
1086949031_1086949036 -6 Left 1086949031 11:92872323-92872345 CCACTGGTGTGGCCTCCCTCTCC 0: 1
1: 0
2: 2
3: 32
4: 418
Right 1086949036 11:92872340-92872362 CTCTCCTCACAGCTGGTTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086949036 Original CRISPR CTCTCCTCACAGCTGGTTTA AGG Intronic
900745496 1:4357900-4357922 CTCTCCCGACAGACGGTTTAGGG - Intergenic
902252015 1:15160113-15160135 TTCTCCTCACATGTGGTCTAGGG + Intronic
904326291 1:29728807-29728829 CCCTCCCCACAGCTGGTGAAAGG + Intergenic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
908110394 1:60891296-60891318 TGCTTCTCAGAGCTGGTTTACGG + Intronic
910112727 1:83700187-83700209 CACTCCTCACAGATGGTCTGGGG - Intergenic
915779799 1:158534796-158534818 CACTCCTCACAGCTGCTCTCCGG + Intergenic
916501814 1:165393840-165393862 TTGTCTTCAGAGCTGGTTTAAGG - Intergenic
917064842 1:171080749-171080771 CTCTCCCCACAGTTGGGTTTTGG - Intergenic
920956917 1:210628108-210628130 CTTAGGTCACAGCTGGTTTATGG - Intronic
922744428 1:228036225-228036247 CTCTCTTCACAGCTGACTGAGGG - Intronic
923578882 1:235188306-235188328 CTTTCCTCACTGCTGGTATGAGG - Intronic
1072610687 10:97015598-97015620 TTCTTCTCTCAGTTGGTTTATGG - Intronic
1073307396 10:102514238-102514260 TTCTCCTCACAGCCTGTTGAGGG + Intronic
1075431601 10:122387778-122387800 CTCTCCGCACAGCTTCTTCATGG + Intronic
1076539256 10:131203874-131203896 CTCCCCTCCCAGCTGGGTTGCGG - Intronic
1076715716 10:132362783-132362805 CTCACCTCACAGCTGCTTGGGGG + Intronic
1077131151 11:973355-973377 CTCACCTCACAGCTGATAGAAGG - Intronic
1078195591 11:9134306-9134328 TTCTTCTCAGAGCTGGTCTATGG + Intronic
1078267745 11:9767460-9767482 CTCCCCTCACAGCTGTATGATGG - Intergenic
1079615362 11:22486171-22486193 TTTTCCTCACAGCTTTTTTAAGG + Intergenic
1080684651 11:34504977-34504999 CTCTCATCACCCCTGGTTTAGGG + Intronic
1080834553 11:35928237-35928259 TTCTCCTCACTTCTCGTTTATGG + Intergenic
1081471840 11:43381308-43381330 TTCTCCTCATTTCTGGTTTATGG - Intronic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1086949036 11:92872340-92872362 CTCTCCTCACAGCTGGTTTAAGG + Intronic
1087324811 11:96708693-96708715 CCCTCCTCACAGCTGGCAGATGG + Intergenic
1087590237 11:100177902-100177924 CTCTCTTCTGACCTGGTTTATGG + Intronic
1088821419 11:113460682-113460704 CTCTCCTCCCACCAGGATTATGG + Intronic
1089580999 11:119481969-119481991 GGCTCCTCACAGCTGGCTTTTGG + Intergenic
1091102011 11:132883458-132883480 CTCTCTTCACACCTGGAATATGG - Intronic
1092182082 12:6452892-6452914 CTCTCCAGAAAGCTGGTTTGGGG + Intronic
1092768380 12:11873473-11873495 CTCATCTAACAGCTGCTTTACGG - Intronic
1096396348 12:51269702-51269724 CTCTCCTGACACCTGGTGGATGG - Intronic
1101788811 12:107910358-107910380 CTCTCTTCACACTTGATTTATGG + Intergenic
1101841270 12:108329020-108329042 CTCTTCTCCAAGCTGGTTTATGG + Intronic
1103930475 12:124448209-124448231 ACCTCATCACAGGTGGTTTAGGG - Intronic
1104733764 12:131123426-131123448 CTCTCAGCACAGCTGGCTTGAGG + Intronic
1105532135 13:21229822-21229844 CTGCCCTCACAGCTAGTTGAAGG - Intergenic
1109052754 13:57506104-57506126 CTCTACTCTCAGCTCCTTTAGGG - Intergenic
1111814598 13:93134975-93134997 CTCTCCTCACACGTGGTGCATGG - Intergenic
1112196803 13:97234419-97234441 CTCTTATCACAGCTGGTTCAAGG - Intronic
1113907823 13:113828430-113828452 TCCTCCTCACACCTGGTTAATGG + Intronic
1114171106 14:20273237-20273259 CTCTCCACACAGCTTCATTAGGG - Intronic
1115881775 14:37927415-37927437 TTCTCCTCACTGCTGCTTTTGGG + Intronic
1116264630 14:42671867-42671889 ATCTCCTCTCATATGGTTTAAGG + Intergenic
1117485789 14:56195433-56195455 CTCCCCTCACAGCTGGTTTGAGG + Intronic
1120104494 14:80479069-80479091 GTCTCCTAACAGCTCTTTTAAGG + Intronic
1121453686 14:94025354-94025376 ATTTCCTCACAACTGGTTTAAGG - Intergenic
1121617698 14:95323897-95323919 CCCTCCTCACAGGTGGATTCTGG - Intergenic
1122042270 14:98997274-98997296 AGCTCCTGAGAGCTGGTTTAAGG + Intergenic
1124099152 15:26677413-26677435 CTTTCCTAAAAGCTGGTTTTGGG + Intronic
1124579848 15:30943868-30943890 CTCTCATCTCAGCTGATTGATGG + Intronic
1126052160 15:44695860-44695882 GTTTCCTCACAGTTGTTTTAGGG + Intronic
1127999586 15:64178343-64178365 CTCTTCTCCCAGCTTGTATAAGG - Intronic
1130034115 15:80342126-80342148 GTCTCCTCACAGCTGGTCCCTGG + Intergenic
1131144096 15:90000611-90000633 CTCTGCTAACAGCTGTTTAAAGG + Intergenic
1133716274 16:8452349-8452371 CTCTCCATCCAGCTGGTGTAAGG - Intergenic
1135655732 16:24247220-24247242 ATCTCCTCCCAGCAGGTTTTTGG - Intergenic
1135822442 16:25695927-25695949 CTCTCTGCACAGCTGGCTTGGGG + Intronic
1141226236 16:82118758-82118780 ATGTCCTCACAGCAGGTTTTGGG - Intergenic
1144105536 17:11981577-11981599 GACTCCTCACATCTGGTTAAAGG + Intronic
1148834515 17:50458812-50458834 GTCCCCTCAAAGCTGGGTTAAGG - Intronic
1149851773 17:60041059-60041081 CTTTCCCCACAGCAGCTTTATGG + Intergenic
1151352693 17:73541144-73541166 CTGTCCTCACAGCTGCTCTGAGG - Intronic
1155242352 18:23875818-23875840 CTCTTCTCACAACTGTTTTGAGG - Intronic
1157754157 18:50203483-50203505 CCCTCCTTACACCTGGCTTATGG + Intergenic
1159276865 18:66233009-66233031 CTTTCCTGACAGCTGCTTCAGGG - Intergenic
1159510446 18:69391817-69391839 CTCTCTCCACAGCTGGTAGATGG + Intergenic
1160044270 18:75372191-75372213 GTCTCCTGACGGCTGCTTTAAGG + Intergenic
1160681038 19:411688-411710 CTCTCCTGCCAGCTGGGTTGGGG + Intergenic
1160740451 19:683155-683177 CTCTCCCCATAGCTGGTCTGAGG - Exonic
1160991235 19:1861141-1861163 CTCCCCTCCCTGCTGGCTTAGGG + Intronic
1162420701 19:10564768-10564790 CTCCCCTCAGGGCTGTTTTAAGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1168373392 19:55855328-55855350 CTCTTTTCACAGTTGGTTTGAGG + Intronic
925846095 2:8034882-8034904 CTCTCATCACAGTTGGTTGTTGG + Intergenic
926419520 2:12682802-12682824 CTCCCCTCTCAGCTGGCTTTGGG + Intergenic
926700816 2:15802052-15802074 CTCTCCACATAGCTGGGTTCAGG + Intergenic
927202944 2:20589793-20589815 GACTCCTCACAGCTGGTGGAGGG + Intronic
929456580 2:42070531-42070553 CTCTCCCCATAGCTGCTTTGAGG + Intergenic
930147017 2:48017670-48017692 TTCTTCTCACAGCTAGTTTAGGG - Intergenic
932961441 2:76417048-76417070 CGCTGCTCACAGCTTGTTTGTGG - Intergenic
933653597 2:84869451-84869473 CTCTTCTTACCCCTGGTTTAAGG - Intronic
938639367 2:133264431-133264453 CCCCCATTACAGCTGGTTTATGG - Intronic
944342034 2:198612448-198612470 CTCTCATCACAAAGGGTTTAGGG - Intergenic
946598965 2:221338552-221338574 CTTTCCTCCCAGCTGGTCTCTGG + Intergenic
947053257 2:226071217-226071239 CTCTCCTTATAGCTGATTTTAGG + Intergenic
1168792957 20:592190-592212 CCCTCCTCAAGGCTGGTGTATGG + Intergenic
1171977818 20:31606572-31606594 CCCTCTTCACAGCTGGTTCTGGG + Intergenic
1173263440 20:41457178-41457200 CTCTTCTTACAGCTGTTTAAGGG - Intronic
1173928537 20:46799029-46799051 CTCTCCTCAGAGCTGGCTCAGGG - Intergenic
1177865945 21:26513485-26513507 CTCTCCCCACAGCAGCTTTATGG - Intronic
1180028315 21:45181741-45181763 CACTCCAGACAGCTGGTTCAGGG + Intronic
1185044191 22:48520774-48520796 ATGTCCTCTCATCTGGTTTAGGG + Intronic
949459406 3:4274070-4274092 GTCTCCTACCAGCTGCTTTAGGG - Intronic
950213795 3:11143268-11143290 CTCTCCACACAGCAGGTTGAGGG - Intronic
953019694 3:39105559-39105581 CTCTCCTAACAGCTGTTTCCTGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955523750 3:59800378-59800400 TTCGCCTCACACCTGCTTTATGG + Intronic
955524784 3:59808899-59808921 CTCTCCTCTAAGCTGTTGTAAGG - Intronic
956804898 3:72799926-72799948 CTCTTCCCCCAGCTGGTTTAAGG + Intronic
957513192 3:81216108-81216130 ATGTCCTCAGAGTTGGTTTAAGG - Intergenic
960668062 3:120130467-120130489 TTCTCCTGACAGCTGGGTTTAGG - Intergenic
960700036 3:120430301-120430323 CTCTTCTCAACCCTGGTTTAAGG + Intronic
961535309 3:127567067-127567089 CACTCTTCACAGCAGGTTTTTGG + Intergenic
962282501 3:134062644-134062666 CTCTCAACACAGCTGCTTTGAGG + Intergenic
964965941 3:162494008-162494030 CTTTCCTCATAGCTTTTTTAAGG - Intergenic
966920259 3:184606394-184606416 CTCTCCTCTCAGCTGGGTTGGGG - Intronic
968088461 3:195885297-195885319 CTCTCCACACAGCTGGGTGTGGG - Intronic
968828361 4:2915991-2916013 CTCTCATCACAGCTGCTGGATGG - Intronic
970405584 4:15759896-15759918 CCCTCCTCACATAGGGTTTATGG - Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
978388405 4:108199690-108199712 TTCTCTTCAAAGCTGGTTTATGG + Intergenic
981757681 4:148158725-148158747 TTATTCTCACAGCTGATTTAAGG + Intronic
982661336 4:158210415-158210437 CTCTCCTCCCGGCCGGTGTATGG + Exonic
988338082 5:29932292-29932314 CTTTCCTTACAGCTGTTCTAAGG - Intergenic
991088291 5:62668514-62668536 AGCTGCACACAGCTGGTTTATGG + Intergenic
992090543 5:73312393-73312415 GTCTCATCTCAGCTGGGTTAAGG - Intergenic
992283110 5:75202875-75202897 CTCTAGTCACAGCAGCTTTAGGG + Intronic
994905698 5:105839112-105839134 CTCCCCTCCCAGCTGCTTTCAGG + Intergenic
997963012 5:138337181-138337203 CTAGCATCACAGATGGTTTAGGG - Intronic
999257650 5:150218658-150218680 CTATCCTCACTGCTGGTGTGTGG - Intronic
999452934 5:151691996-151692018 CTCTCCTCACATCAGGGTTTTGG - Intergenic
999460150 5:151750768-151750790 CTGTACTCACAGCTAATTTAGGG - Intronic
1003390561 6:5709339-5709361 CTGCCCTCACAGCTGGTTGAAGG + Intronic
1005674948 6:28144509-28144531 ATCTCATGACAACTGGTTTAGGG + Intronic
1006948391 6:37800905-37800927 CTCTCTTCACAGCTGATCTCAGG + Intergenic
1007741455 6:44012346-44012368 CTCTCCTCAGAGGTGGTTTGTGG - Intergenic
1008928536 6:56912739-56912761 CTCTCCACTCTGCTGGATTATGG + Intronic
1014213526 6:118731167-118731189 CTCACCTCTCAGGTGGTTTTTGG - Intergenic
1018295976 6:162344542-162344564 CTGCCCTCACAGCTGGGTCAGGG + Intronic
1018814862 6:167323009-167323031 CTCTCATCCCAGGTGGTTGATGG - Intergenic
1019506302 7:1393178-1393200 CTGTCCTTGCAGCTGTTTTAGGG + Intergenic
1020913020 7:14157140-14157162 CTCTACTCACAGATATTTTATGG - Intronic
1021533525 7:21676025-21676047 CTCCTATCACAGCTGTTTTAAGG - Intronic
1022177396 7:27884977-27884999 CTCCCCTCAGAGCAGGTTTGAGG + Intronic
1024896929 7:54270959-54270981 CTCTCATCTCAGCTTGTTCATGG + Intergenic
1031804999 7:126297128-126297150 CTTTCCTCACTGCTTGTTTTTGG - Intergenic
1032017510 7:128389311-128389333 CTCTCCTCACATCTGGAGTCAGG - Intergenic
1032754479 7:134875641-134875663 CTGGGCTCACAGATGGTTTAAGG - Intronic
1038568541 8:28639665-28639687 CCCTCCTGACAGCTGCTTTTTGG + Intronic
1040519106 8:48160035-48160057 CTCTCCCCAGAGCTGGTTGTGGG + Intergenic
1040603066 8:48903477-48903499 CTCTTCTCAAAGCTTGTCTAAGG - Intergenic
1046648243 8:116809042-116809064 CTGTCTTCACAGGTGGTTTCAGG + Intronic
1051806345 9:20996835-20996857 CTCTCCTCACAGCCAGTATCTGG + Intergenic
1055919252 9:81440869-81440891 CTATCATCACATCTGGTTTTTGG - Intergenic
1056033991 9:82584506-82584528 CTTTCCTAACAGCCGGTTTATGG + Intergenic
1056678187 9:88694736-88694758 CGCTTCTCCCAGCTGGTTTCAGG + Intergenic
1057170469 9:92960382-92960404 CTCTGCTCTGGGCTGGTTTATGG - Intronic
1060157324 9:121328879-121328901 CTCCCCTCACAGATGGCTTCTGG + Exonic
1186504435 X:10079677-10079699 CATTCTTCACAGCTGGTTTTTGG + Intronic
1189396615 X:40628828-40628850 CTCGCTTGGCAGCTGGTTTATGG - Intronic
1195324925 X:103750765-103750787 GACACCTGACAGCTGGTTTAAGG + Intergenic
1195364804 X:104115506-104115528 CTCTCTTCTCTGCTGGCTTAAGG + Exonic
1197124623 X:122929884-122929906 CTCACCTCACAGATGGTTCTAGG - Intergenic
1199142314 X:144327599-144327621 CTATGCACACTGCTGGTTTATGG + Intergenic