ID: 1086949323

View in Genome Browser
Species Human (GRCh38)
Location 11:92875547-92875569
Sequence CTGGTTTACCAGCACACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 5, 2: 7, 3: 30, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086949323 Original CRISPR CTGGTTTACCAGCACACCCC TGG (reversed) Intronic
901052393 1:6431871-6431893 CTGGTTCACCAGCATATCACTGG - Intronic
902260888 1:15223984-15224006 CTGGTTCAGCTGCACTCCCCAGG - Intergenic
902481844 1:16716148-16716170 CTGGTTCACCAGCATATCACTGG + Intergenic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
902971917 1:20059969-20059991 CTGCTTTTCCAGCACCCCCAAGG + Intronic
905243739 1:36597892-36597914 CCGATTTACCAGCACACTACTGG + Intergenic
910159786 1:84260433-84260455 CTGGCTCCCCAGCCCACCCCTGG - Intergenic
911488203 1:98528499-98528521 GTGGTTTAGCACCACACCCATGG + Intergenic
913296202 1:117323047-117323069 CCAGTTAACCAGCACACCGCTGG + Intergenic
913509946 1:119552426-119552448 GTGGTTTCCCAGCACTTCCCTGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
918321161 1:183366039-183366061 CTGGTATACCACTACACCCTGGG + Intronic
918904505 1:190475566-190475588 CTGGTTGACCAGCTGGCCCCAGG - Intronic
921559502 1:216640221-216640243 CTGGTTTGCCAGCAAGCCCAAGG + Intronic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
923148502 1:231214225-231214247 CTGAGCTACCAGCACTCCCCAGG - Intronic
923912978 1:238470428-238470450 CTGGTTTACCAGCACATTCATGG + Intergenic
1067956899 10:50801507-50801529 CTGGTTTTCCAGGACAGTCCTGG - Exonic
1070189393 10:74097866-74097888 TTGGCTTACCAGCACATCGCTGG - Intronic
1070399614 10:76041850-76041872 CTGGGTTCCCGGCACACACCTGG - Intronic
1070556148 10:77529260-77529282 GTGGTTTCCCAGCTCACCTCTGG + Intronic
1078857895 11:15221347-15221369 CTGGCTTCCCAGAACAGCCCAGG - Intronic
1085389931 11:76177113-76177135 CTGGGTTAACTGTACACCCCTGG + Intergenic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1090429346 11:126633195-126633217 CTGATTTCCCAACACACACCGGG + Intronic
1091143493 11:133256920-133256942 CTGGTCTACCAGCCCACCACTGG - Intronic
1094372174 12:29750465-29750487 CTTATTTACCAGGACACTCCTGG + Intronic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1096509463 12:52119737-52119759 TTTGTTTACCGGCTCACCCCAGG + Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1101473434 12:105020978-105021000 ATATTTTACCAGCACACCCCTGG + Exonic
1102460513 12:113097000-113097022 CTGGGCTACCAGGACACACCTGG - Exonic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1103899164 12:124294658-124294680 CTCGGTTACCCGCACACCCAGGG - Intronic
1103969375 12:124660514-124660536 CAGGTATACCTGCACACCCCGGG - Intergenic
1104624434 12:130339654-130339676 CAGGTTTCCCAGCACAACTCTGG - Intronic
1105324226 13:19355605-19355627 CTGGCTTACCAGCACACCCCCGG - Intergenic
1105869038 13:24487799-24487821 CTGGCTTACCAGCACACCCCCGG + Intronic
1107053447 13:36077395-36077417 CTGGTTTGCCAGCATCCCCCTGG + Intronic
1107152657 13:37129807-37129829 CTGGTTTAACAGCAAAGCCTTGG + Intergenic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1108516268 13:51205821-51205843 TTGGTTTACCAGCGTACCACTGG + Intergenic
1110368350 13:74712951-74712973 CTTGTCTACCAGCACATCACTGG - Intergenic
1111750948 13:92330834-92330856 ATGGCTGACCAGCACACTCCAGG + Intronic
1113668537 13:112159147-112159169 CTGGTTTACCAGGACCTCCCCGG - Intergenic
1118912193 14:70070805-70070827 CTGGTTTATTAGCTCACCACTGG - Intronic
1122155792 14:99749711-99749733 CTGACTTACCAGCCCAGCCCTGG + Intronic
1124439986 15:29678659-29678681 CTGCATAACCAGCACACCCGGGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1130764657 15:86857741-86857763 CTCATTTACCAGGACATCCCTGG + Intronic
1132851280 16:2026181-2026203 CTTGTGTCCCAGCCCACCCCAGG - Intronic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1135876221 16:26202690-26202712 CTGTATAACAAGCACACCCCAGG - Intergenic
1136013235 16:27378408-27378430 TTGGCTTACCAGCACACCACTGG + Intergenic
1136351129 16:29708862-29708884 CTGGTTTACCAGGAAAGCCCTGG + Intergenic
1140406922 16:74717377-74717399 CTGGTTTTCCAGCACATCACTGG - Intronic
1140424384 16:74848648-74848670 GTGGGTCACCAGCACACCACAGG + Intergenic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1141967496 16:87456185-87456207 CTGGAATCCCAGCACAACCCAGG + Intronic
1142220743 16:88853800-88853822 CGGGTCTACCTGCACTCCCCAGG - Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1148448174 17:47754027-47754049 CTGGTTTACTACCACACCACTGG + Intergenic
1148875579 17:50684926-50684948 CAGGTTTCCCAGCACCCGCCAGG - Intronic
1148984134 17:51606812-51606834 CTGGTCTACCAGCACACCAATGG - Intergenic
1150480594 17:65506021-65506043 TTGGTTTACCAGCATACCACTGG - Intergenic
1150863343 17:68823697-68823719 CAGGTTTACCAGCACACTCCTGG + Intergenic
1150893829 17:69185905-69185927 CTGGTTTACCAGGAAAACACAGG + Intronic
1151545721 17:74791705-74791727 CAGGTTCACCAGCACACTTCAGG - Intronic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152110464 17:78355005-78355027 GTGGCTGACCAGCAGACCCCAGG + Intergenic
1152736802 17:82001129-82001151 CTGGTTTACCCCCAAAACCCTGG - Intronic
1157761787 18:50270655-50270677 CTGGGTTTCCTGCAGACCCCAGG - Intronic
1158470484 18:57731681-57731703 CTGGTTCAACAGCAGACCCCTGG + Exonic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
928424626 2:31167907-31167929 CAGTTTTACCAGCCCACCCCTGG + Intergenic
929116929 2:38452461-38452483 CTTGTTTGCCAGATCACCCCAGG + Intergenic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
929568518 2:43005606-43005628 GTGGGCTCCCAGCACACCCCCGG - Intergenic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
931704244 2:64934038-64934060 CTGGTTGACCAGCACTCCCTGGG - Intergenic
935197182 2:100824196-100824218 TTGGTTTACCAGCAAACCCAAGG + Intronic
935487151 2:103671931-103671953 ATGGTTTACCACCACTCCTCCGG - Intergenic
936516320 2:113183536-113183558 CTGTGTTCCCAGCACAGCCCCGG - Intronic
937298020 2:120821492-120821514 CTGGTTTACAAGCCCATCCGAGG - Intronic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
940134454 2:150420772-150420794 CTGGTTGACCAGCTCACTTCTGG - Intergenic
941656330 2:168148670-168148692 GTGGTATTCCAGCACACCCACGG + Intronic
942094023 2:172521123-172521145 GTGGGTTACCACCACACACCTGG + Intergenic
942734832 2:179097498-179097520 CTGGTTTACATGCACCCTCCAGG + Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
944676495 2:202036834-202036856 CTGCTTGACAAGCACACCGCAGG - Exonic
947166094 2:227263886-227263908 CTGGTGAACCAGCACAACCTGGG - Exonic
1169333114 20:4731941-4731963 CTGGTACACTAGCACACCTCTGG - Exonic
1169640967 20:7751796-7751818 ATTGTTTACCAGCCCACCCAAGG + Intergenic
1172810547 20:37644652-37644674 CTTGTTCACCAGCATATCCCTGG - Intergenic
1174891400 20:54399050-54399072 CTGGGTTACAAACTCACCCCAGG - Intergenic
1175311573 20:58015371-58015393 CTGGTTCACCAGCACACCCCTGG - Intergenic
1176264426 20:64201692-64201714 CCTGTTTACCAGCACACGCTGGG + Intronic
1178488694 21:33034305-33034327 CTGGTTTACCATCCCTACCCTGG + Intergenic
1179592181 21:42416128-42416150 CTGGGTAACGTGCACACCCCGGG + Intronic
1180130587 21:45824522-45824544 CTGGTTCTACAGCACACCTCTGG - Intronic
1180173107 21:46071066-46071088 CAGGTTCACCTGCACAGCCCTGG - Intergenic
1181050527 22:20236314-20236336 CTGTTTCACCAGCACACAGCAGG + Intergenic
1182457880 22:30463474-30463496 GTGGGTTACCAGCACAGTCCAGG - Intronic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1182813098 22:33134646-33134668 CTGGACCTCCAGCACACCCCAGG + Intergenic
1183672816 22:39283123-39283145 CTGGGTCCCCAGCACAGCCCAGG - Intergenic
1184188404 22:42879306-42879328 CTGGTTTCCCAGAAGACCTCAGG + Intronic
1184693330 22:46127281-46127303 CTGGCTCCCCAGCACAGCCCTGG + Intergenic
954156970 3:48690878-48690900 CTGGTTCACCAGACCACCACTGG - Intronic
954806214 3:53222422-53222444 CTGGGTTGCCAGCACCCCCTGGG + Intergenic
955328296 3:58026407-58026429 GGGGTTTACCACCACACCCAGGG - Intronic
955487498 3:59449345-59449367 CTTGTTTACAATCACAGCCCTGG - Intergenic
955609351 3:60740697-60740719 CTGGTTTAAGAGAACAACCCTGG - Intronic
962477714 3:135771074-135771096 CGAGTTTACCATCATACCCCAGG - Intergenic
963852870 3:150225287-150225309 CTGGTTTACCAGCATACTTTTGG - Intergenic
964174432 3:153808747-153808769 CTTATTTACCAGCACACTACTGG + Intergenic
967186482 3:186948838-186948860 CTGGTTTCTCTGCACAGCCCTGG + Intronic
968762636 4:2450548-2450570 CTGCTTTGCCAACACATCCCAGG - Intronic
971217026 4:24671363-24671385 CCGGGTTACCTGCAAACCCCTGG - Intergenic
971236579 4:24847947-24847969 CTGGTTCAGGAGCACACCTCAGG + Intronic
973342368 4:49018249-49018271 ATGGTTTAGCACCACACCCTCGG - Intronic
974622930 4:64384723-64384745 CTGGTTTATCTCCATACCCCTGG + Intronic
975582215 4:75917381-75917403 CTGGTTTACTAGCAGACCACTGG + Intronic
976222764 4:82771273-82771295 CTGGTTTACTAACATACCCTGGG + Intronic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981973975 4:150700900-150700922 GGGGTGTACCACCACACCCCTGG + Intronic
985072117 4:186176550-186176572 CTGGTTTTCCTTCACATCCCAGG - Intergenic
987388580 5:17353895-17353917 CTCTTTGACCAGCACACCCTGGG - Intergenic
989399237 5:40991547-40991569 CTGATTTACCAGCAGAACACTGG + Intergenic
994443214 5:99836669-99836691 ATGGTTTAACAGCATTCCCCTGG + Intergenic
997380461 5:133432646-133432668 TTGGTTTACCACCAAATCCCTGG - Intronic
998711695 5:144833241-144833263 CTGATTTACTAGCACCACCCTGG + Intergenic
999082532 5:148857660-148857682 CTGGCTGACTAGCACACCACTGG - Intergenic
1002695493 5:181085710-181085732 CTGGTCTCCCAGCCCACCTCAGG + Intergenic
1003032988 6:2618884-2618906 CAGGTTTTCCAGGAGACCCCAGG - Intergenic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1007716053 6:43856953-43856975 CTGGTTCACCATCAAATCCCAGG - Intergenic
1008688916 6:53956160-53956182 CTGCTGTACCAGCAGAGCCCAGG + Intronic
1009935958 6:70234830-70234852 CTGTTCTCCCTGCACACCCCGGG + Exonic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1015336484 6:132044882-132044904 CTGGTTTAGCAACATACCACTGG + Intergenic
1015403576 6:132813736-132813758 CCGCTTTACCAACACACCGCAGG + Intergenic
1015617087 6:135088750-135088772 CTGGCTTACCAGTTCACCACTGG - Intronic
1015622057 6:135141641-135141663 CTGGTTAAACAGCACACCACTGG - Intergenic
1017245303 6:152217796-152217818 CTGATTTCCCAGCTCACTCCTGG - Intronic
1017471615 6:154742969-154742991 CTGGTTTACCACTATATCCCAGG - Intronic
1019224487 6:170498844-170498866 CTGAGTGACCAGGACACCCCAGG + Intergenic
1022639753 7:32170804-32170826 TTGTTTTAAAAGCACACCCCTGG - Intronic
1024564843 7:50672720-50672742 CTGGCTTTCCAGCCCACCCTCGG + Intronic
1027525451 7:79263412-79263434 CTGGTTTCCCAGCTGACACCAGG + Intronic
1031782758 7:125990646-125990668 CTCCTTTTCCAGCATACCCCAGG + Intergenic
1033552184 7:142457635-142457657 CCAGTTTATCAGCACATCCCTGG + Intergenic
1035236922 7:157503364-157503386 CTGGTTCAGCAGCACTTCCCTGG - Intergenic
1035825559 8:2640953-2640975 CTGGTTTATCTGCACAGCTCAGG - Intergenic
1037922522 8:22817431-22817453 CTGGGTTACCAGCATACCACTGG + Intronic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1046969111 8:120201498-120201520 TACATTTACCAGCACACCCCTGG + Intronic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1048770950 8:137894511-137894533 CTGTTTTTCCAGCTCTCCCCAGG + Intergenic
1049637420 8:143696560-143696582 CTGCCTTACCAGGACACCACCGG + Intronic
1053271231 9:36750818-36750840 CTGGTTTGCCAGGACAGCCCTGG - Intergenic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1059779981 9:117515972-117515994 ATGGTTTACCACCACCCCCCTGG - Intergenic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1061034247 9:128104682-128104704 CTGGTTTAAAGGCACACGCCAGG - Intronic
1061883799 9:133581163-133581185 CTGGTTTATCAGCACAGCCCAGG - Intronic
1186213059 X:7270423-7270445 CTGGCTTTCCTGCACACACCTGG - Intronic
1186812151 X:13200923-13200945 TTGGTTTATAAGCCCACCCCAGG + Intergenic
1187199505 X:17121294-17121316 AAGGTTTACCAACACACCACTGG - Intronic
1187306834 X:18102784-18102806 GTGTCTTCCCAGCACACCCCAGG + Intergenic
1187592492 X:20733612-20733634 CTGGTTTAAAAGCACACCACTGG + Intergenic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1194680220 X:96843110-96843132 ATGGTTTACCACCACCGCCCTGG + Intronic
1197074088 X:122334979-122335001 CTGGTTTACCAGCACAGTACTGG - Intergenic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198250422 X:134874598-134874620 CTGGTTTTCCTGCAAGCCCCTGG + Intergenic
1198990089 X:142503379-142503401 CTGGTTTACTAGCATATCACTGG + Intergenic
1199721242 X:150544027-150544049 CTAGTTCACCTGCTCACCCCTGG - Intergenic
1199951009 X:152706271-152706293 AAGGTTGACCAGCACAGCCCTGG - Intergenic
1199953309 X:152722895-152722917 AAGGTTGACCAGCACAGCCCTGG - Intergenic
1199956373 X:152745555-152745577 AAGGTTGACCAGCACAGCCCTGG + Intergenic
1199958675 X:152762190-152762212 AAGGTTGACCAGCACAGCCCTGG + Intergenic