ID: 1086953758

View in Genome Browser
Species Human (GRCh38)
Location 11:92915584-92915606
Sequence CTTCGTGGCAGGCGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086953744_1086953758 25 Left 1086953744 11:92915536-92915558 CCCGGTGTGTTTGTGTATCCCCG No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data
1086953745_1086953758 24 Left 1086953745 11:92915537-92915559 CCGGTGTGTTTGTGTATCCCCGC No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data
1086953749_1086953758 6 Left 1086953749 11:92915555-92915577 CCCGCGGTGCAGGCCGACTGCGC No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data
1086953750_1086953758 5 Left 1086953750 11:92915556-92915578 CCGCGGTGCAGGCCGACTGCGCG No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data
1086953752_1086953758 -7 Left 1086953752 11:92915568-92915590 CCGACTGCGCGGTGCTCTTCGTG No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data
1086953748_1086953758 7 Left 1086953748 11:92915554-92915576 CCCCGCGGTGCAGGCCGACTGCG No data
Right 1086953758 11:92915584-92915606 CTTCGTGGCAGGCGGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086953758 Original CRISPR CTTCGTGGCAGGCGGCTGGG CGG Intergenic
No off target data available for this crispr