ID: 1086954836

View in Genome Browser
Species Human (GRCh38)
Location 11:92925332-92925354
Sequence TTTTAGCCATAACTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086954836_1086954845 14 Left 1086954836 11:92925332-92925354 CCTAGCTCCAGTTATGGCTAAAA No data
Right 1086954845 11:92925369-92925391 TCACAGGCTGCTGCTCCAGAGGG No data
1086954836_1086954840 -2 Left 1086954836 11:92925332-92925354 CCTAGCTCCAGTTATGGCTAAAA No data
Right 1086954840 11:92925353-92925375 AAGGGCCCCAGATATGTCACAGG No data
1086954836_1086954844 13 Left 1086954836 11:92925332-92925354 CCTAGCTCCAGTTATGGCTAAAA No data
Right 1086954844 11:92925368-92925390 GTCACAGGCTGCTGCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086954836 Original CRISPR TTTTAGCCATAACTGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr