ID: 1086955730

View in Genome Browser
Species Human (GRCh38)
Location 11:92933202-92933224
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086955730_1086955738 21 Left 1086955730 11:92933202-92933224 CCTTGCATGTCCAAGCTGCACAC No data
Right 1086955738 11:92933246-92933268 TGGACATGCCTCAGGCCTAAAGG No data
1086955730_1086955732 1 Left 1086955730 11:92933202-92933224 CCTTGCATGTCCAAGCTGCACAC No data
Right 1086955732 11:92933226-92933248 CAGCTTCACCCACCACTCCATGG No data
1086955730_1086955736 13 Left 1086955730 11:92933202-92933224 CCTTGCATGTCCAAGCTGCACAC No data
Right 1086955736 11:92933238-92933260 CCACTCCATGGACATGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086955730 Original CRISPR GTGTGCAGCTTGGACATGCA AGG (reversed) Intergenic