ID: 1086955731

View in Genome Browser
Species Human (GRCh38)
Location 11:92933212-92933234
Sequence GTGAAGCTGTGTGTGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086955731_1086955736 3 Left 1086955731 11:92933212-92933234 CCAAGCTGCACACACAGCTTCAC No data
Right 1086955736 11:92933238-92933260 CCACTCCATGGACATGCCTCAGG No data
1086955731_1086955741 26 Left 1086955731 11:92933212-92933234 CCAAGCTGCACACACAGCTTCAC No data
Right 1086955741 11:92933261-92933283 CCTAAAGGCACTCATTCTAATGG No data
1086955731_1086955732 -9 Left 1086955731 11:92933212-92933234 CCAAGCTGCACACACAGCTTCAC No data
Right 1086955732 11:92933226-92933248 CAGCTTCACCCACCACTCCATGG No data
1086955731_1086955738 11 Left 1086955731 11:92933212-92933234 CCAAGCTGCACACACAGCTTCAC No data
Right 1086955738 11:92933246-92933268 TGGACATGCCTCAGGCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086955731 Original CRISPR GTGAAGCTGTGTGTGCAGCT TGG (reversed) Intergenic