ID: 1086955738

View in Genome Browser
Species Human (GRCh38)
Location 11:92933246-92933268
Sequence TGGACATGCCTCAGGCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086955731_1086955738 11 Left 1086955731 11:92933212-92933234 CCAAGCTGCACACACAGCTTCAC No data
Right 1086955738 11:92933246-92933268 TGGACATGCCTCAGGCCTAAAGG No data
1086955730_1086955738 21 Left 1086955730 11:92933202-92933224 CCTTGCATGTCCAAGCTGCACAC No data
Right 1086955738 11:92933246-92933268 TGGACATGCCTCAGGCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086955738 Original CRISPR TGGACATGCCTCAGGCCTAA AGG Intergenic