ID: 1086957155

View in Genome Browser
Species Human (GRCh38)
Location 11:92945191-92945213
Sequence CTGTAGCCTTACATGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086957155_1086957160 -2 Left 1086957155 11:92945191-92945213 CCAAGGCCCATGTAAGGCTACAG No data
Right 1086957160 11:92945212-92945234 AGGGAGCCAAATACCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086957155 Original CRISPR CTGTAGCCTTACATGGGCCT TGG (reversed) Intergenic
No off target data available for this crispr