ID: 1086957160

View in Genome Browser
Species Human (GRCh38)
Location 11:92945212-92945234
Sequence AGGGAGCCAAATACCTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086957154_1086957160 -1 Left 1086957154 11:92945190-92945212 CCCAAGGCCCATGTAAGGCTACA No data
Right 1086957160 11:92945212-92945234 AGGGAGCCAAATACCTTCTCTGG No data
1086957159_1086957160 -9 Left 1086957159 11:92945198-92945220 CCATGTAAGGCTACAGGGAGCCA No data
Right 1086957160 11:92945212-92945234 AGGGAGCCAAATACCTTCTCTGG No data
1086957158_1086957160 -8 Left 1086957158 11:92945197-92945219 CCCATGTAAGGCTACAGGGAGCC 0: 5
1: 5
2: 4
3: 12
4: 114
Right 1086957160 11:92945212-92945234 AGGGAGCCAAATACCTTCTCTGG No data
1086957155_1086957160 -2 Left 1086957155 11:92945191-92945213 CCAAGGCCCATGTAAGGCTACAG No data
Right 1086957160 11:92945212-92945234 AGGGAGCCAAATACCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086957160 Original CRISPR AGGGAGCCAAATACCTTCTC TGG Intergenic
No off target data available for this crispr