ID: 1086960686

View in Genome Browser
Species Human (GRCh38)
Location 11:92977637-92977659
Sequence AACAAGGTGGTGGGAACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086960686_1086960695 12 Left 1086960686 11:92977637-92977659 CCCACTGTTCCCACCACCTTGTT 0: 1
1: 0
2: 2
3: 15
4: 274
Right 1086960695 11:92977672-92977694 CCAGCTCTCACCTAATTGAATGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086960686 Original CRISPR AACAAGGTGGTGGGAACAGT GGG (reversed) Intronic
900580794 1:3407754-3407776 TGCAGTGTGGTGGGAACAGTGGG - Intronic
900941275 1:5800105-5800127 AAGAAGGGGGTGGGCCCAGTGGG + Intergenic
901810671 1:11765423-11765445 AAAGAGGTGGTGGGGGCAGTGGG - Intronic
904674779 1:32192283-32192305 ACAAAGATGGTGGGAGCAGTCGG - Intronic
905224743 1:36471831-36471853 AACAAGTTGGTGGACACAGCAGG + Intronic
908163842 1:61437977-61437999 AAGCAGGTGATGGGCACAGTGGG + Intronic
910006824 1:82407267-82407289 AATAAGGTAGTGGGAATAGAGGG + Intergenic
911566749 1:99471448-99471470 AACAATGTGGTGGTCACAATGGG - Intergenic
917502027 1:175594303-175594325 AGCAAAGAGGTGGGAAGAGTGGG - Intronic
917708388 1:177657933-177657955 AACAAGGATGTGGGAACTGGTGG + Intergenic
917965504 1:180176092-180176114 GAGAGGGTGGTGGGAACAGCAGG + Intronic
918065201 1:181095877-181095899 AACAAGCAGGTGGGAACACATGG - Intergenic
919327553 1:196127932-196127954 AACAAGGTGGAGTGGAGAGTTGG + Intergenic
919527566 1:198672766-198672788 AAAATGGTGCTGGGCACAGTGGG - Intronic
920016265 1:202912043-202912065 CACAAGGTGGATGGAAGAGTTGG + Intronic
920909172 1:210198240-210198262 ATCAAGGTACTGGGAACATTTGG + Intergenic
921752160 1:218808074-218808096 TAGAAGGTGGGGGTAACAGTGGG - Intergenic
921823175 1:219640853-219640875 AAGAAAGTGGAGGGAAGAGTGGG + Intergenic
922741266 1:228015596-228015618 CTCAGGGTGGTGGGAACAGCAGG - Intronic
923239990 1:232074336-232074358 AAGAACTTGGTGGGAAGAGTAGG + Intergenic
924123372 1:240825029-240825051 AACTAGGTGGTTTAAACAGTAGG - Intronic
924429609 1:243985733-243985755 AACAAGTTGGTGAACACAGTGGG + Intergenic
1063124010 10:3124309-3124331 CACTTGGAGGTGGGAACAGTGGG + Intronic
1064097675 10:12435970-12435992 AATGGGGTGGTGGGGACAGTCGG + Intronic
1064800187 10:19061703-19061725 ACAAAGGTGGTGGGAAAATTGGG + Intronic
1065119587 10:22515587-22515609 AACAAGGTGGTGGGCACAGAGGG + Intergenic
1065338300 10:24677839-24677861 AACAAGGTTGGGTAAACAGTAGG - Intronic
1068019778 10:51566957-51566979 AACAAGGTAGTGGTAACTATGGG + Intronic
1069753402 10:70759335-70759357 AAGAGGGAGGTGGGAAGAGTGGG - Intronic
1070413673 10:76168983-76169005 AACAAGGTGGGGAGAAAAGAAGG + Intronic
1071324658 10:84501138-84501160 ACCAAGGTGGTGGGAGAAGGAGG - Intronic
1072300736 10:94059318-94059340 AACAACATGGTGGGAAGAGATGG + Intronic
1073103954 10:101021781-101021803 ATCAAGGTGGGCAGAACAGTGGG - Exonic
1073286162 10:102390027-102390049 TTCCAGGTGGAGGGAACAGTAGG - Intergenic
1074340248 10:112621389-112621411 AACAAGATGGGGGGAAATGTTGG + Intronic
1075537785 10:123285625-123285647 GACAAGGTTGTGGGAACATCCGG - Intergenic
1077242536 11:1518121-1518143 AACAAGGGTCTGGGGACAGTAGG + Intergenic
1078572103 11:12468211-12468233 CTCAAGGTGGTGGGAAAGGTAGG - Intronic
1080685439 11:34511485-34511507 CACAAGGTGGTGGAATCAGGTGG + Intronic
1081445824 11:43130655-43130677 AACAAAGTGGGGGGAAGAGGAGG + Intergenic
1084429586 11:69103659-69103681 AATAATGTGGTAGGAACAGGTGG + Intergenic
1085083254 11:73650435-73650457 AAAAAGGTGGTTGTAACACTAGG + Intronic
1085758762 11:79223826-79223848 ACCCACGTGGTGGGAGCAGTGGG - Intronic
1086436638 11:86787858-86787880 AACAACCTGGTGAGATCAGTAGG + Intergenic
1086529662 11:87769940-87769962 ACCAAGGTGGGGAGATCAGTTGG + Intergenic
1086960686 11:92977637-92977659 AACAAGGTGGTGGGAACAGTGGG - Intronic
1087116721 11:94533394-94533416 AACAAGGTGGTGGCTAGAATTGG - Intergenic
1087376947 11:97354623-97354645 AACAAGGATGTGAAAACAGTAGG - Intergenic
1089594374 11:119567886-119567908 AATAAGGTGGTGGCATCAGCTGG + Intergenic
1090049622 11:123366285-123366307 AACAAGTTAGCAGGAACAGTAGG + Intergenic
1090728057 11:129545209-129545231 AATGAAGGGGTGGGAACAGTTGG + Intergenic
1091978674 12:4848138-4848160 GACAAGGTGGTGGGATGAGTAGG + Intronic
1094802730 12:34055872-34055894 GGCAAGGGGGTGGGGACAGTAGG + Intergenic
1095116142 12:38354363-38354385 GGCAAGGGGGTGGGGACAGTAGG + Intergenic
1096617883 12:52844542-52844564 ACCAAGGTGGTGGGACCTGGGGG - Exonic
1099742942 12:86665047-86665069 AACAAGGTGGTGGGGGGAGGGGG - Intronic
1104008735 12:124914353-124914375 AACAAGGTGGGGGGCATGGTGGG - Exonic
1105365438 13:19760176-19760198 AACTGGGTGGTGGGTACAGATGG - Intronic
1106038063 13:26063330-26063352 AAAGAGGTGGGGGGAACACTGGG + Intergenic
1107272260 13:38633953-38633975 TGCAAGGTGCTGGGAACAGGTGG - Intergenic
1111608478 13:90572294-90572316 TACTAGATGCTGGGAACAGTAGG - Intergenic
1113769724 13:112900323-112900345 GACAAGGTGGTGAGCACAGCTGG + Intronic
1114386954 14:22265537-22265559 AACAAGGGGAAGGGAACAGCAGG + Intergenic
1114642663 14:24233874-24233896 ACCTGGGTGGTGGGAAAAGTTGG - Intronic
1116452617 14:45082184-45082206 AAAAGGGCTGTGGGAACAGTAGG + Intergenic
1117707938 14:58492453-58492475 AACAAGGTGGTTGGAACAGATGG - Intronic
1118747888 14:68786911-68786933 ACTAAGGTGGTGGGAACCCTTGG + Intergenic
1120036945 14:79708612-79708634 GACAAGGTGGTGGGAGGGGTGGG + Intronic
1120185432 14:81388971-81388993 AAAAAGGTGGTGGGAGGAGAAGG - Intronic
1121064254 14:90946493-90946515 AGCAAGGTGGAGGTAACAGGTGG - Intronic
1123979632 15:25589030-25589052 AGCATGGAGGTGGGAACAGGTGG + Intergenic
1124341151 15:28889728-28889750 GCCAAGGGGGTGGGAACAGCAGG - Intronic
1124480270 15:30073400-30073422 AACTACGTGGTGGGAAGTGTAGG - Intergenic
1124639436 15:31387619-31387641 AACTGGGTGGTGGGAAAAGTGGG + Intronic
1124965968 15:34433968-34433990 GCCAAGGGGGTGGGAACAGCAGG + Intronic
1124982588 15:34580067-34580089 GCCAAGGGGGTGGGAACAGCAGG + Intronic
1125391104 15:39194093-39194115 ACCACGGTGGTGGGAGCAGGAGG + Intergenic
1130024233 15:80257447-80257469 AAAAAGGTGGCAGGAACATTGGG + Intergenic
1130203809 15:81857152-81857174 AACAAGGATGTGGAAACATTGGG + Intergenic
1131675309 15:94665173-94665195 AACAAGGTGGTGTGAGCTATGGG - Intergenic
1131879465 15:96847180-96847202 AAAAAGGGGGTGGGTACTGTGGG - Intergenic
1134030766 16:10990589-10990611 AACAATGGAGTGGGCACAGTGGG + Intronic
1134041229 16:11070039-11070061 AACAAGGTGCTGGGAGAAGCTGG - Intronic
1135192776 16:20368317-20368339 AACAAGGAGGTGGGAGCACAGGG + Intronic
1136098734 16:27977778-27977800 CTCATGGTGGTGGGGACAGTGGG - Intronic
1139019372 16:62728395-62728417 AAAAGGGTGGTGGGAAGAATGGG + Intergenic
1139395213 16:66633381-66633403 AACAAGGTGGTGGGAGTATTGGG - Intronic
1139513706 16:67441279-67441301 ACCCAGCAGGTGGGAACAGTAGG - Intronic
1140713382 16:77698935-77698957 AACAAGCAGGTTGGAAAAGTTGG - Intergenic
1141206369 16:81935943-81935965 TAAAAGGTGGTGGGAAAACTAGG + Intronic
1142852403 17:2710651-2710673 GACACGGTGGAGGGAACAGAAGG + Intronic
1143554684 17:7652660-7652682 TCCAGGGTGGTGGGAACAGCCGG + Intronic
1146453431 17:32992050-32992072 AACAAGGTGGTGGTTAGGGTGGG + Intronic
1146931312 17:36780092-36780114 CACTGGGTGGTGGGAACAGGTGG + Intergenic
1147233620 17:39039188-39039210 TACAATTTGGTGGGAAGAGTGGG + Intergenic
1147818652 17:43228603-43228625 ACAGAGGTGGTGGGAGCAGTGGG - Intergenic
1147819123 17:43231397-43231419 ACAGAGGTGGTGGGAGCAGTGGG + Intergenic
1147831935 17:43303305-43303327 ACAGAGGTGGTGGGAGCAGTGGG - Intergenic
1147832406 17:43306102-43306124 ACAGAGGTGGTGGGAGCAGTGGG + Intergenic
1148019862 17:44546562-44546584 AGGAAGGTGGTGGGAATGGTGGG + Intergenic
1148362566 17:47024437-47024459 TACAATTTGGTGGGAAGAGTGGG + Intronic
1148757983 17:49984555-49984577 AACCTGGGGATGGGAACAGTGGG - Intergenic
1149199976 17:54173862-54173884 CTCAAGATGGTGGGAACCGTAGG + Intergenic
1150050256 17:61955119-61955141 AGCCATGTGGTGGAAACAGTGGG - Intronic
1150451317 17:65271225-65271247 AACAAAGTGGTGGGAAAAGAGGG + Intergenic
1155810918 18:30233954-30233976 AAGAAGGCAGTGGGAAAAGTAGG - Intergenic
1155951479 18:31918267-31918289 AAGTAGGTTGTGGGAACACTAGG - Intronic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1156767629 18:40677401-40677423 AGTAGGGTAGTGGGAACAGTAGG - Intergenic
1157012206 18:43663774-43663796 AACTGGGTGTTGGGTACAGTAGG + Intergenic
1157720823 18:49922925-49922947 AGCAAGGTGGAATGAACAGTAGG + Intronic
1157744937 18:50127161-50127183 CACAGTGTGGTGGGAAGAGTAGG - Intronic
1158882711 18:61796331-61796353 AACAAGGTGGTGTGGACAGAAGG + Intergenic
1159988568 18:74874860-74874882 AACAGTGTGTTGGGGACAGTGGG + Intronic
1163026468 19:14515722-14515744 CATCAGGTGGTGGGAACAGCAGG - Exonic
1163702678 19:18794050-18794072 TACGAGGTGGGGGGAACAGCAGG - Intergenic
1166540237 19:43600242-43600264 AACAGGCTGGAGGGAGCAGTGGG + Exonic
927631393 2:24777253-24777275 AAAAAGCTGGTGAGAACTGTAGG + Intergenic
928645964 2:33352940-33352962 TACAAGGGGGAGGGCACAGTAGG - Intronic
929322070 2:40556286-40556308 CTTAAGTTGGTGGGAACAGTAGG + Intronic
929395692 2:41519700-41519722 AAGGAGGTGGAGGAAACAGTTGG - Intergenic
929444629 2:41992347-41992369 TAGAAGGTTGTGGGAATAGTGGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932666208 2:73700938-73700960 GAGAAGGTGGTGGGCACAGTAGG - Intergenic
933620063 2:84528506-84528528 ATCAAGGTGGTCAGAACAGAGGG + Intronic
935765271 2:106360500-106360522 AACAAGGTGGTGGTTACATAGGG - Intergenic
936261891 2:110966740-110966762 AATGAGGTGGTGGGAAAAGGGGG + Intronic
936851049 2:116898397-116898419 CAAAAGGTGCTGGGAACTGTGGG - Intergenic
937512589 2:122612423-122612445 AGCGAGGTAGTGGTAACAGTGGG + Intergenic
939078261 2:137628787-137628809 TACAAGGTGATGGAGACAGTGGG - Intronic
939078266 2:137628814-137628836 TACAAGGTGATGGAGACAGTGGG - Intronic
939503638 2:143016826-143016848 ACCTAGGTGATGGGATCAGTAGG - Intronic
941695322 2:168544789-168544811 CACGTGGTGCTGGGAACAGTTGG + Intronic
945333960 2:208570047-208570069 GACAAAGTGGTGGGGAAAGTTGG - Intronic
946883713 2:224201966-224201988 AACAATGTGGCTGGAACAGAAGG - Intergenic
947347166 2:229204529-229204551 AACAAAATGGTGGGCACAGATGG - Intronic
948938434 2:241183591-241183613 AACAATGGGGTGAGAACAGGAGG - Exonic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1172063554 20:32203720-32203742 AACAAGATGATGGGATCAGCGGG + Intronic
1173396927 20:42688756-42688778 ACCAGGGTGCTGAGAACAGTGGG - Intronic
1175057886 20:56214630-56214652 AAAAAGGTGGTGGGGAAGGTAGG + Intergenic
1175244512 20:57573500-57573522 ATCAAGTTGGAGGGAACTGTGGG + Intergenic
1175368483 20:58471172-58471194 CCCAAGGTGCTGGGGACAGTGGG + Intronic
1178007980 21:28244831-28244853 CACAAGGTGATTTGAACAGTAGG + Intergenic
1178937878 21:36880126-36880148 AACATGGTGCTGGAAACATTTGG + Intronic
1179714114 21:43279041-43279063 ACCAAGGTGGAGGGGACGGTAGG - Intergenic
1181733811 22:24866771-24866793 AACACTGTGGCCGGAACAGTGGG + Intronic
1181933757 22:26425160-26425182 AACAAGGAATTGGGAGCAGTAGG - Intergenic
1183591552 22:38782045-38782067 AAGAATGTGGTGAGAACTGTGGG - Intronic
950531071 3:13552654-13552676 TATAGGGTGGTGGGAGCAGTGGG + Intronic
954425564 3:50441105-50441127 ACCCAGGTGGTGGGGACAGGGGG + Intronic
956095967 3:65716510-65716532 CACAGAGTGGTAGGAACAGTGGG + Intronic
957951099 3:87127894-87127916 AACTAGGTGGTGGTCTCAGTTGG + Intergenic
959472553 3:106770361-106770383 AAAATGGTGGTGGGAGCAGCTGG - Intergenic
960171835 3:114471503-114471525 AACAAGGTGGTGGGTCCAGCAGG + Intronic
961066399 3:123880753-123880775 AAGAAGGTGGTGGGAGCATCTGG + Intronic
961505924 3:127370400-127370422 AACAGGGTGGTGGGAGCAGAGGG + Intergenic
962380047 3:134891051-134891073 AGCATTGTTGTGGGAACAGTAGG - Intronic
963952309 3:151216277-151216299 AGAAAGATTGTGGGAACAGTGGG + Intronic
966941870 3:184753007-184753029 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966941909 3:184753184-184753206 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966941913 3:184753200-184753222 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966941917 3:184753216-184753238 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966941922 3:184753232-184753254 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966941933 3:184753274-184753296 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942035 3:184753689-184753711 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942039 3:184753705-184753727 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942044 3:184753721-184753743 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942171 3:184754212-184754234 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942178 3:184754241-184754263 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942192 3:184754296-184754318 AAGAAGGTGGTGGGAGAAGGAGG + Intergenic
966942226 3:184754428-184754450 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942233 3:184754457-184754479 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942266 3:184754586-184754608 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942280 3:184754647-184754669 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942287 3:184754676-184754698 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942293 3:184754705-184754727 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942304 3:184754753-184754775 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942308 3:184754769-184754791 AAGAAGGTGGTGGGAGAAGAAGG + Intergenic
966942313 3:184754785-184754807 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942321 3:184754814-184754836 AAGAAGGTGGTGGGAGAAGGTGG + Intergenic
966942346 3:184754923-184754945 AAGAAGGTGGTGGGAGAAGGAGG + Intergenic
967035816 3:185647578-185647600 AACGAGGAGGAGGGAACAGCAGG - Intronic
967988342 3:195112911-195112933 CCCCAGGTGGTGGGAACAGCTGG + Intronic
969281948 4:6176733-6176755 ATCAAAGTGGTGGGAAAAGCTGG + Intronic
970603105 4:17655633-17655655 AACAGGTTGCTGGGATCAGTGGG - Intronic
971273389 4:25172355-25172377 AACAAGGTAGTAGGAACATGAGG + Intronic
972096649 4:35355205-35355227 AAAAATGTGGTGGGATCAATAGG + Intergenic
973022382 4:45219998-45220020 CACAAGGGGTTGAGAACAGTGGG - Intergenic
974790459 4:66681968-66681990 AACAGGGTGGTGGATCCAGTGGG - Intergenic
974856841 4:67470910-67470932 AACAAGGTCCTGGAAACAGAAGG + Intergenic
975118862 4:70706654-70706676 AATAAGGAGGTGTGAACACTGGG - Intronic
976010232 4:80477700-80477722 TAAAAGGTGGTAGGAACAGTAGG - Intronic
979133067 4:117073040-117073062 AACATAGTGCTGGAAACAGTAGG + Intergenic
980636970 4:135518621-135518643 GACAAGGTGCTGGGTAGAGTAGG + Intergenic
980969314 4:139555218-139555240 AACAAAGTGGCGAGAAAAGTCGG + Intronic
981941071 4:150282028-150282050 AGCTTGGTGGTGGGAGCAGTAGG - Intronic
983452968 4:167929875-167929897 AACAAGGTGCTGGCAACTGGGGG + Intergenic
988810052 5:34776118-34776140 AACAACGTGGTTGGAACTGGAGG + Intronic
989786117 5:45332782-45332804 AACAACGTGGATGGAACAGGAGG - Intronic
989969436 5:50504770-50504792 AACATGATAGTGGGAATAGTGGG - Intergenic
991418716 5:66418611-66418633 ACCATGGTGGTCGGAGCAGTTGG - Intergenic
991715782 5:69449785-69449807 AGCAATGTGGTGAAAACAGTCGG + Intergenic
992166156 5:74054049-74054071 AGCAAGGAGCTGGGAACAGTGGG - Intergenic
992930857 5:81643484-81643506 AGAAAATTGGTGGGAACAGTAGG - Intronic
994233975 5:97340050-97340072 AGCCAGGTAGTGGTAACAGTGGG + Intergenic
995576198 5:113537584-113537606 AACAAGAGGATGGGAATAGTGGG - Intronic
995770703 5:115665881-115665903 AGCAAGGTAGTGGTTACAGTGGG + Intergenic
996702067 5:126460231-126460253 CACAAGTTGCTGGGAAGAGTAGG + Intronic
997632522 5:135379474-135379496 AAGAGGGTGGTGGGAAGAGACGG + Intronic
997801349 5:136865760-136865782 AACTAGGTGGGGGGAGCAGTAGG - Intergenic
998427300 5:142039722-142039744 AACAAGGTGGTGGCATCTTTTGG + Intergenic
1000636793 5:163653662-163653684 AACCAGAGGCTGGGAACAGTAGG - Intergenic
1001032221 5:168271313-168271335 AACCAGGTGCTGGGGACAGAGGG + Intergenic
1001665561 5:173431028-173431050 AACAAGTTGGTGTGCACAGAGGG + Intergenic
1002864919 6:1112904-1112926 AACCAGGTGCTGGGGACAGGAGG - Intergenic
1003353874 6:5346578-5346600 AAAATGTTGGTGGGAAAAGTAGG - Intronic
1004528797 6:16434879-16434901 AACGGGGTGATGGGAACAGTTGG + Intronic
1004898726 6:20174019-20174041 AAAAAGGATGTGGTAACAGTTGG + Intronic
1006569809 6:34993058-34993080 AACAAGGGGGTGGGAGTAGGGGG - Intronic
1007556091 6:42767792-42767814 AACAGGAGGGTGGGAAAAGTGGG + Intronic
1008345606 6:50422840-50422862 GGCAAGGTGGTAGGATCAGTAGG + Intergenic
1009620681 6:66072041-66072063 AAGAAGGTGGTGGGGAAAGGAGG + Intergenic
1009673037 6:66780981-66781003 AACAACGTGGTTGGAACTGGAGG + Intergenic
1010042203 6:71398025-71398047 AACAAGGTTGTCTGAACAATTGG + Intergenic
1010908303 6:81520667-81520689 AGCAATGTGTTGGGAAGAGTGGG - Intronic
1010917172 6:81634385-81634407 AAGCAGGTGGTCAGAACAGTAGG - Intronic
1011322754 6:86115421-86115443 AGCCAGGTGGTGGTTACAGTGGG - Intergenic
1012219684 6:96633693-96633715 AACAAGGTGGTGAGTGCCGTGGG - Intergenic
1015338807 6:132074041-132074063 AACAAGGTAGTGAGTATAGTTGG + Intergenic
1016594419 6:145783401-145783423 AACAAGGTATTGGAAACAGGAGG - Intergenic
1018064867 6:160117854-160117876 TACAAGGTGGAGGGAAGAGCAGG - Intergenic
1018579116 6:165292369-165292391 GAAAGGGTGATGGGAACAGTGGG + Intronic
1019120418 6:169799507-169799529 AACCAGGAGGTGGCAACAGCAGG + Intergenic
1021217285 7:17932669-17932691 CACATGGAGGTGGGAACAGCAGG + Intronic
1022089853 7:27100961-27100983 GACAAGCAGTTGGGAACAGTGGG + Exonic
1022385460 7:29894725-29894747 AACAAGCAGGTGGGGACAGAGGG - Intronic
1025243239 7:57295499-57295521 AACTAAGTGGTGGGCACAGGTGG + Intergenic
1026360707 7:69599132-69599154 AAAAAGGTCGCGGGAAAAGTGGG - Intronic
1026669162 7:72372225-72372247 GTCATGGTGGTGGGGACAGTAGG + Intronic
1027998443 7:85458149-85458171 AACTAAGTGGTGGGGAAAGTGGG + Intergenic
1028101323 7:86824226-86824248 AATAAGATGGTGGGAAAAGAAGG + Intronic
1028295306 7:89122550-89122572 GACAAGGTGGTGGGAATGGATGG - Intronic
1028929439 7:96397111-96397133 AGCGAGGTGGTGGTTACAGTGGG - Intergenic
1031189191 7:118525142-118525164 AACAAGGTGGGGAGAGCATTAGG - Intergenic
1032433657 7:131882753-131882775 AACAAGGTGGTAGCTCCAGTTGG - Intergenic
1034279734 7:149844715-149844737 AACAAGCTGGTGGCACCACTGGG + Exonic
1034384343 7:150726443-150726465 AACATGGTGGTGGGTCCAGAAGG - Intronic
1034454573 7:151160362-151160384 AACTCTGTAGTGGGAACAGTGGG - Intronic
1036611786 8:10356566-10356588 CACAAGGTGATGGGATTAGTAGG + Intronic
1037742122 8:21616321-21616343 AGGAAGGTGGTGGGGACAATGGG + Intergenic
1037887169 8:22601214-22601236 GACAAGCTGGTGGGAGCTGTTGG - Exonic
1038380710 8:27090563-27090585 AACAAGATGGTGGAAACTGGAGG - Intergenic
1039994992 8:42524334-42524356 AACATGGTGGTGGGGGGAGTGGG + Intronic
1040035126 8:42862702-42862724 CAGAAGGTGGTGAGAACAGCAGG + Intronic
1041606980 8:59793129-59793151 AGGAAGGAGGTGGGAAGAGTGGG + Intergenic
1041711059 8:60894925-60894947 CATAAGGTGGTGGGAGCAGCAGG + Intergenic
1042169059 8:65974800-65974822 AACAAGGTATTGGGAACTGGGGG + Intergenic
1048197547 8:132344722-132344744 AGAAAGCTGGTGGGGACAGTTGG + Intronic
1048547274 8:135398766-135398788 GCCAATCTGGTGGGAACAGTTGG - Intergenic
1049251094 8:141589358-141589380 AGCAAGGTGGGGGGAACTATAGG + Intergenic
1051580287 9:18665650-18665672 AAGAAGATGGTGGGAACAAAAGG - Intronic
1051925955 9:22325579-22325601 AAAAAGTTGGTGAGAAAAGTTGG + Intergenic
1052600462 9:30621625-30621647 ACCAAGTTGGTGAGAACTGTGGG - Intergenic
1056046544 9:82723980-82724002 ACCAAAGTGCTGGGGACAGTAGG - Intergenic
1057766118 9:97920940-97920962 AACAGGGAGGTGGGAACCTTTGG - Intronic
1058725498 9:107799704-107799726 AACAAGGTGCAGGGAAGAGAGGG - Intergenic
1059570123 9:115425296-115425318 AACAAGGTGCTGGGTATAGCTGG + Intergenic
1060369231 9:123053916-123053938 AACAAGGTACTGGGAACTGTAGG - Intronic
1061444602 9:130630854-130630876 CACAAGGTGGTGGGAAAAGCTGG - Intronic
1187574150 X:20536557-20536579 AACAAAGTGATGGGCACATTGGG + Intergenic
1188075031 X:25765043-25765065 AACAAGTTGGTGAGGACATTAGG + Intergenic
1188611746 X:32107855-32107877 ATCAAAGTAGTGGTAACAGTAGG + Intronic
1189624629 X:42883241-42883263 AAAAAGGTGGTGGGGAGAGATGG + Intergenic
1190015223 X:46820527-46820549 AACCAGGTGGTGGTTACAGAGGG + Intergenic
1191188430 X:57638849-57638871 AACCAGGTAGTGGTCACAGTGGG + Intergenic
1193098420 X:77579305-77579327 AACCAGGTAGTGGTTACAGTGGG + Intronic
1193210062 X:78797103-78797125 AACCAGGTTGTGGTTACAGTAGG - Intergenic
1195120679 X:101748335-101748357 GAAATGGTGTTGGGAACAGTTGG + Intergenic
1195613845 X:106897225-106897247 AACAAGGTGGGAGAAACAGGAGG + Intronic
1197715757 X:129705022-129705044 AAGAAGGTTGTGGGAGCAGCTGG - Intergenic
1198697137 X:139354427-139354449 AATAAGGTAGTGGTTACAGTGGG - Intergenic
1200701342 Y:6405189-6405211 TACAAGGTGCAGGGAACATTTGG - Intergenic
1201032769 Y:9759509-9759531 TACAAGGTGCAGGGAACATTTGG + Intergenic
1202119693 Y:21509979-21510001 AACAAGGTGGTAGGCACTGGCGG - Intergenic
1202122146 Y:21533520-21533542 AACAAGGTGGTAGGCACTGGCGG - Intronic
1202156861 Y:21895863-21895885 AACAAGGTGGTAGGCACTGGCGG + Intronic
1202159307 Y:21919404-21919426 AACAAGGTGGTAGGCACTGGCGG + Intergenic
1202176146 Y:22100652-22100674 TACAAGGTGCAGGGAACATTTGG - Intergenic
1202185756 Y:22184319-22184341 AACAAGGTGGTAGGCACTGGCGG + Intergenic
1202205604 Y:22402077-22402099 AACAAGGTGGTAGGCACTGGCGG - Intronic
1202215215 Y:22485732-22485754 TACAAGGTGCAGGGAACATTTGG + Intergenic