ID: 1086970178

View in Genome Browser
Species Human (GRCh38)
Location 11:93073023-93073045
Sequence TGTTCTCTGCAGGAGTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086970178_1086970181 2 Left 1086970178 11:93073023-93073045 CCCAGTTACTCCTGCAGAGAACA No data
Right 1086970181 11:93073048-93073070 ACAATTGTAGAACCTAAGATTGG No data
1086970178_1086970183 24 Left 1086970178 11:93073023-93073045 CCCAGTTACTCCTGCAGAGAACA No data
Right 1086970183 11:93073070-93073092 GCCTTTTGAGATATCTTTTCAGG 0: 42
1: 144
2: 176
3: 145
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086970178 Original CRISPR TGTTCTCTGCAGGAGTAACT GGG (reversed) Intergenic
No off target data available for this crispr