ID: 1086978504

View in Genome Browser
Species Human (GRCh38)
Location 11:93165983-93166005
Sequence TCCCCACAACCTTCCAATAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086978504_1086978506 -1 Left 1086978504 11:93165983-93166005 CCACTATTGGAAGGTTGTGGGGA 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1086978506 11:93166005-93166027 ATCTGGCATGTTCTAAAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086978504 Original CRISPR TCCCCACAACCTTCCAATAG TGG (reversed) Exonic
900827271 1:4936870-4936892 TCCCCACAGCCTTTCCAGAGAGG - Intergenic
902610245 1:17592874-17592896 TCCCCATAACCCTCCCATGGGGG - Intronic
904861374 1:33540648-33540670 ACCCCACCACCTTCCCATTGGGG + Exonic
904913884 1:33955635-33955657 TCACCACAACCCTACAATATAGG - Intronic
912644954 1:111383603-111383625 TCCCCTCCACCTTCCAGTAAAGG + Intergenic
913238638 1:116807755-116807777 TCCCCAGAAGCTTTCAGTAGTGG - Intergenic
915204645 1:154261072-154261094 TCCCCAGCACCTTCCAGTATGGG + Exonic
918817388 1:189206131-189206153 TCCTCACAACCTTGAACTAGTGG + Intergenic
919756721 1:201070615-201070637 AGCCCACAACCTTCCAGAAGTGG + Intronic
923389315 1:233498309-233498331 TCCCCACCAGCTTACATTAGGGG + Intergenic
923681848 1:236124757-236124779 TCCCCACAACCCCCAAATGGGGG - Intergenic
1065803280 10:29372048-29372070 TCCCAACAACCTTACAATGTTGG + Intergenic
1066513433 10:36128059-36128081 TGCTCACAACCTTCCAAGAAAGG + Intergenic
1066981966 10:42424657-42424679 TCCCCACAACAAACCTATAGAGG - Intergenic
1068366032 10:56051268-56051290 TCTCCACGAGCTTGCAATAGAGG + Intergenic
1068747422 10:60548986-60549008 TGCCCACAATATTCCAATTGAGG - Intronic
1069616260 10:69808173-69808195 TCCCCACCACCTTCCTATGAGGG - Intronic
1075195994 10:120359539-120359561 TCCCACCAACCTTCAAACAGAGG + Intergenic
1076450809 10:130555842-130555864 TCTCCACAACCATCAAATGGAGG - Intergenic
1076661469 10:132058468-132058490 TCCCCACAACCTTTCTCTGGAGG + Intergenic
1080007967 11:27429601-27429623 TCCAAACAACCTGCAAATAGAGG + Intronic
1082892181 11:58151567-58151589 GCCCCACAAGCTTTCAACAGAGG - Intronic
1084665209 11:70572593-70572615 TCCCCACAACATTCCACTTCCGG + Intronic
1086412241 11:86554245-86554267 TCCACACATCCTGGCAATAGGGG + Intronic
1086978504 11:93165983-93166005 TCCCCACAACCTTCCAATAGTGG - Exonic
1092771585 12:11902055-11902077 TCCCCACAACCTTCCTTCTGAGG - Intergenic
1096135769 12:49199077-49199099 TTCCCCCAACCTTCCAAATGTGG + Intronic
1102033565 12:109758581-109758603 TCCCCACACCCCTCCCATAAAGG + Intronic
1103725617 12:122996079-122996101 TCCCCTCACCCTTCCAAAAAAGG - Intronic
1105358071 13:19678365-19678387 TACCCAAAACATTTCAATAGAGG + Intronic
1107149931 13:37099260-37099282 TTGCCACCACCTTCCAACAGCGG - Intergenic
1108617487 13:52148656-52148678 TCCCCACCCCCTTCAAATTGGGG + Intronic
1109009993 13:56928285-56928307 TCCCCACTACTTTCCAATAGTGG + Intergenic
1109718079 13:66243335-66243357 TCCTCACACCCTTCCTATACAGG - Intergenic
1109941059 13:69366047-69366069 TCCCCACCAACTTCATATAGTGG + Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1114451521 14:22829642-22829664 TTCCCACAACCTCCCTACAGCGG - Intronic
1117709845 14:58516196-58516218 TCCCCACAATCTTTCTCTAGAGG - Intronic
1202903589 14_GL000194v1_random:56334-56356 ACTCCACCACCTTCCAAGAGAGG - Intergenic
1124325457 15:28757201-28757223 AACCCACAACCTTCCAGTATGGG + Intergenic
1125896390 15:43306282-43306304 GCCACACAACCTTCAAATAGAGG - Intergenic
1126995385 15:54437205-54437227 TCCCCAGAAAGTTCCAAAAGAGG + Intronic
1129677830 15:77642016-77642038 TTCCCACAACCCTCCAAGATAGG - Intronic
1131362164 15:91802834-91802856 TCACCACAAGCTTCCAATTCAGG + Intergenic
1135942221 16:26832043-26832065 TCCCCTCTTGCTTCCAATAGAGG + Intergenic
1139528940 16:67532532-67532554 TCCCCAAACACTTCCTATAGAGG + Intronic
1141742524 16:85903512-85903534 TCCCCACGGGCTTCCATTAGAGG + Intronic
1143513238 17:7407077-7407099 TCCCCCCAACCTTAACATAGAGG - Intronic
1144529732 17:16025495-16025517 TCCTCATAAGCTTCTAATAGGGG - Intronic
1144793405 17:17874736-17874758 TCCCCACAGCCTTCCCACTGGGG + Intronic
1145288460 17:21523552-21523574 TTCCAACAACCTTCCCAGAGGGG - Intergenic
1150568214 17:66361928-66361950 TCCCCACAGCCTTGCTATAGAGG + Intronic
1152939314 17:83159440-83159462 TCCCCAGAACCTTCTATTACAGG + Intergenic
1154011526 18:10578884-10578906 TCCCCACATCCCTGCTATAGAGG - Intergenic
1159473569 18:68888477-68888499 ACCCCACAACATGTCAATAGCGG - Intronic
1159762264 18:72443141-72443163 TCACCACATCCTTGCAAAAGAGG + Intergenic
1160856706 19:1221054-1221076 TCTTCACCACCTTCCACTAGTGG - Intronic
1162343372 19:10105740-10105762 TCCCCAAAACCTTGCAGTGGGGG - Intergenic
1163154434 19:15432403-15432425 TCCCCACACCCTCCCAAGCGCGG + Intronic
1164139147 19:22441899-22441921 TCACCACAACCTTCAAATCCCGG + Intronic
1164881350 19:31735146-31735168 TCCCCATAACAGTCCAATAAGGG + Intergenic
927417317 2:22892631-22892653 TCCCCACAACCTTGAAAATGAGG + Intergenic
933723964 2:85415803-85415825 TCCTCACAACCTTCCAAGGTAGG - Intronic
934503077 2:94874087-94874109 ACTCCACCACCTTCCAAGAGAGG + Exonic
935857165 2:107287652-107287674 AACCCTCAACCTTCCAAAAGAGG - Intergenic
937550332 2:123080956-123080978 TTCCCCCAACCTTGCAATAGAGG - Intergenic
939483860 2:142783652-142783674 TCGCAACAACCTTGCAATGGAGG - Intergenic
942350347 2:175046184-175046206 TCACCACAACCTTCCCTTCGTGG + Intergenic
944807973 2:203301119-203301141 TCACCACAACCTTCCCCTACTGG - Intronic
944842483 2:203637678-203637700 TCCCCACAACCTCCTTAAAGGGG - Intergenic
946168340 2:217878849-217878871 TCCCCTCTACCTGCCTATAGCGG - Intronic
946403457 2:219480869-219480891 TCCCCACACCCCTCCATAAGAGG + Intronic
946448232 2:219757993-219758015 TGCCCACAACCTACCAGAAGAGG + Intergenic
1168955591 20:1832297-1832319 ACCCAAAAACCTTCCAGTAGGGG - Intergenic
1169388399 20:5170083-5170105 TCCCAACAACCTTCCGAGACAGG + Intronic
1177544283 21:22535812-22535834 TGCCAACAACATTCCAATAGGGG - Intergenic
1185256907 22:49838938-49838960 GCCCCACAGCCCTCCCATAGGGG + Intergenic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954461317 3:50628648-50628670 TGCCCACAGCCTTCCCACAGAGG - Intronic
955415238 3:58685615-58685637 CCCCCACAACCTTCCTTTGGTGG + Intergenic
955887248 3:63613764-63613786 TCCCAACTACCTTCCAAGAAAGG + Intronic
964391870 3:156206207-156206229 TCCCCATAACCTGACAATGGAGG - Intronic
966009482 3:175056896-175056918 AACCCACAACCTTCCAATGTGGG + Intronic
969964837 4:10983446-10983468 TCACCACCACCTTCCACCAGAGG - Intergenic
973257074 4:48124286-48124308 CCACCACCACCTTCCAATTGTGG + Intronic
973844089 4:54893217-54893239 TCCCCTAAACCTTTCAAGAGTGG - Intergenic
975167499 4:71193583-71193605 ACCCCACATCCTTACAAAAGGGG + Intronic
976605199 4:86976144-86976166 TCCCCACATCCTTCCACTGCAGG - Intronic
979123416 4:116932720-116932742 TCTCCACAACTTTCCATAAGAGG + Intergenic
992106753 5:73454624-73454646 TTCTCAAAACCTTCCACTAGAGG + Intergenic
992134019 5:73724116-73724138 TTCCCACAACATTTTAATAGAGG - Intronic
992177103 5:74160501-74160523 TCCCCAAAACCTTTCATTATAGG + Intergenic
996621798 5:125514203-125514225 TCCCCACAACTTCCCAGTGGTGG - Intergenic
998843777 5:146283998-146284020 TCCCCAGCAAATTCCAATAGGGG - Intronic
999688473 5:154123758-154123780 TTCCCCCAACCTACCAATACAGG + Intronic
999877092 5:155819540-155819562 TCCCCACAACCTTGTAAAATTGG + Intergenic
1001836248 5:174835210-174835232 TCCTCACAACCCTCCTATTGTGG - Intergenic
1003880028 6:10471560-10471582 TTCCTTCAACCTTCAAATAGTGG + Intergenic
1004577352 6:16909961-16909983 TCCCCACAACCTTCACGTATAGG - Intergenic
1004952458 6:20689167-20689189 TCCCCTCATGCTTCCAGTAGGGG - Intronic
1007073663 6:39053619-39053641 TCCCCACAGCCATCCCATGGGGG + Intronic
1008148578 6:47922386-47922408 TCACCACCACCTTCCCATTGTGG + Intronic
1012054874 6:94393640-94393662 TCCCCTCAACTTTCCATTTGGGG - Intergenic
1017744834 6:157436932-157436954 TCCCCACCACCTTCCACTCCAGG - Intronic
1023485519 7:40682165-40682187 TCCCCACAGCCTGCTAAAAGAGG + Intronic
1029917479 7:104226580-104226602 TCCCCACAACTTTACAAATGAGG - Intergenic
1030967868 7:116016357-116016379 TCTCCACATTCTTCCCATAGAGG + Intronic
1032699034 7:134362664-134362686 TCCCCTCAACATTGCAAGAGAGG + Intergenic
1034435399 7:151060681-151060703 TCCCCACACCCTTCCCAGACTGG + Intronic
1035944870 8:3951196-3951218 TCCCCACAAACTACCTATACAGG - Intronic
1038362120 8:26890992-26891014 TCCCCACATCCTTCCAACACTGG - Intergenic
1041374908 8:57203510-57203532 CCCCCAAAACCTACCAATGGAGG - Intergenic
1044604717 8:94038648-94038670 TCACCAGAACCTTACAATACAGG + Intergenic
1045009204 8:97943266-97943288 TCCCCACAACCATCCTCTGGAGG + Intronic
1049048684 8:140173651-140173673 TCCCCACATACCTCCAGTAGGGG + Intronic
1050784939 9:9389099-9389121 TCACCACAACCTTATAATGGAGG - Intronic
1052023702 9:23552565-23552587 TCCCAACAATCATCAAATAGGGG + Intergenic
1055645228 9:78356684-78356706 TCCACAAAACCTTCCAAAACGGG - Intergenic
1057046970 9:91893490-91893512 TCCCCACACCCCTCCACTGGGGG + Intronic
1058061469 9:100501296-100501318 TCCCCTCAACCTTTTGATAGTGG + Intronic
1058281508 9:103121850-103121872 TCCCCTTATGCTTCCAATAGTGG + Intergenic
1059542208 9:115142413-115142435 TTCCCACAACCTGCCAACACTGG + Intronic
1060031991 9:120222481-120222503 TCCCCCCATGGTTCCAATAGCGG - Intergenic
1060883184 9:127133129-127133151 TCCCCACCACCTTCACAGAGGGG + Intronic
1061398421 9:130355658-130355680 TCCCCAGAGCCTTCCAAGCGAGG - Intronic
1203563964 Un_KI270744v1:77951-77973 ACTCCACCACCTTCCAAGAGAGG + Intergenic
1187807634 X:23138400-23138422 CCCCCATAACCTTCCAATTATGG + Intergenic
1189583686 X:42435074-42435096 TGGCCACAACATTCCAATGGGGG - Intergenic
1190569292 X:51765720-51765742 TACCCACAACCCTTCAATATTGG - Intergenic
1191919440 X:66239039-66239061 AACCCACAACCTTCCAATGTGGG + Intronic
1192232391 X:69274512-69274534 TCCCCACATCCCTCCACCAGGGG + Intergenic
1193286847 X:79723906-79723928 ACCCCACCACTTTCCAAGAGAGG + Intergenic
1194913262 X:99673422-99673444 AACCCACAACCTTCCAGTATGGG + Intergenic
1198179568 X:134192980-134193002 TCCCCACAACCTTGCCAAAATGG - Intergenic
1201159469 Y:11156543-11156565 ACTCCACCACCTTCCAAGAGAGG - Intergenic
1201307910 Y:12567025-12567047 TCACCACAACCTTCTAAGGGAGG + Intergenic