ID: 1086980965

View in Genome Browser
Species Human (GRCh38)
Location 11:93197681-93197703
Sequence GCCAAGCGCGGGGCCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086980956_1086980965 12 Left 1086980956 11:93197646-93197668 CCACGGGGTCAGTTAGCAATCGG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1086980965 11:93197681-93197703 GCCAAGCGCGGGGCCCCTGGAGG 0: 1
1: 0
2: 2
3: 16
4: 176
1086980953_1086980965 28 Left 1086980953 11:93197630-93197652 CCTTTGCGGATGCTGACCACGGG 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1086980965 11:93197681-93197703 GCCAAGCGCGGGGCCCCTGGAGG 0: 1
1: 0
2: 2
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086980965 Original CRISPR GCCAAGCGCGGGGCCCCTGG AGG Intronic