ID: 1086981014

View in Genome Browser
Species Human (GRCh38)
Location 11:93197872-93197894
Sequence CTCTCCCGCCGCTGCGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086981009_1086981014 -5 Left 1086981009 11:93197854-93197876 CCGCCGCCCGAGTGCTCACTCTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
1086981008_1086981014 3 Left 1086981008 11:93197846-93197868 CCAGGACGCCGCCGCCCGAGTGC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
1086981007_1086981014 20 Left 1086981007 11:93197829-93197851 CCATCTCTCGCGGGTCTCCAGGA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
1086981010_1086981014 -8 Left 1086981010 11:93197857-93197879 CCGCCCGAGTGCTCACTCTCCCG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
1086981003_1086981014 29 Left 1086981003 11:93197820-93197842 CCGCCGCTTCCATCTCTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132
1086981005_1086981014 26 Left 1086981005 11:93197823-93197845 CCGCTTCCATCTCTCGCGGGTCT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086981014 Original CRISPR CTCTCCCGCCGCTGCGTGGC CGG Exonic
900158254 1:1212040-1212062 GTCTCCTGGGGCTGCGTGGCTGG + Exonic
900404183 1:2485336-2485358 CTTCCCCTCCGCTGCCTGGCTGG - Intronic
900582507 1:3416036-3416058 TTCTCCCGCCCCTGCGAGGCAGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901789901 1:11648656-11648678 CTCTCCCCCAGCTGCCTGGAGGG - Exonic
903738276 1:25543917-25543939 CTTTCCCGGCCCTGCGGGGCAGG + Intronic
904470590 1:30733714-30733736 CCCTCCCGCCCCTCCCTGGCAGG - Exonic
914918014 1:151830226-151830248 CTCTGCTGCTGCTGCGTGGCCGG + Intronic
1069784950 10:70981769-70981791 CCCTCCCTCCGCTGAGGGGCTGG - Intergenic
1070850621 10:79559342-79559364 CTCTCCCGTCCCTGCCTGGCAGG + Exonic
1070856597 10:79611945-79611967 CTCTCCCGTCCCTGCCTGGCAGG - Exonic
1071527785 10:86367808-86367830 CTCTCCCCCTGGTGCGTGGCGGG - Intergenic
1076581967 10:131517849-131517871 GGCTTCCTCCGCTGCGTGGCAGG - Intergenic
1076849349 10:133085585-133085607 GTCTCCGGGCGCTGTGTGGCAGG - Intronic
1076947826 10:133664499-133664521 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076948816 10:133667809-133667831 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
1076949800 10:133671108-133671130 CTCTGCCGGCGCGGCCTGGCTGG - Intronic
1076950784 10:133674407-133674429 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076951774 10:133677717-133677739 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076952763 10:133681027-133681049 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076953747 10:133684326-133684348 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076954731 10:133740678-133740700 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076955720 10:133743988-133744010 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076956710 10:133747298-133747320 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076957697 10:133750607-133750629 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076958682 10:133753906-133753928 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076959671 10:133757216-133757238 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1076960655 10:133760515-133760537 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1081716250 11:45252500-45252522 TTCTCCCGTCACAGCGTGGCCGG - Exonic
1083424370 11:62575508-62575530 CTCTGCCAGGGCTGCGTGGCTGG + Exonic
1083843841 11:65319758-65319780 CTCTCCCGCCCAAGCCTGGCGGG - Intronic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1089457667 11:118634833-118634855 CCCTCCCGCCGCTGCCGGGCCGG + Intronic
1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG + Intronic
1096789850 12:54037889-54037911 CTCACCAGCAGCTGCGTGGCTGG - Intronic
1096840924 12:54378977-54378999 CCCGCCCGCCCCTGCGGGGCTGG - Intronic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1101493870 12:105235853-105235875 CACTCCCGCGGCTGCCCGGCCGG + Intronic
1102232126 12:111269876-111269898 CTCTCCCGCCCCTGCATTTCTGG - Intronic
1104386273 12:128354274-128354296 CCCTCCCTCCACTGAGTGGCCGG - Intronic
1105378041 13:19863128-19863150 CTCTCCTGCCGCATAGTGGCGGG - Intronic
1108834221 13:54520871-54520893 CTCTCCCACCGCTGAATGACAGG + Intergenic
1118809100 14:69260750-69260772 CTCTCCCGGCTCTGCGCTGCCGG + Intronic
1121535735 14:94689665-94689687 CTCTGGCGCCGCCTCGTGGCGGG - Intergenic
1202852590 14_GL000225v1_random:30726-30748 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1202860672 14_GL000225v1_random:79380-79402 CTCTGCCGGCGCGGCCTGGCTGG + Intergenic
1202868221 14_GL000225v1_random:136393-136415 CTCTGCCGGCGCGGCTTGGCTGG + Intergenic
1202921982 14_KI270723v1_random:35326-35348 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
1202922946 14_KI270724v1_random:2287-2309 CTCTGCCGGCGCGGCCTGGCTGG + Intergenic
1125673983 15:41493199-41493221 CTCCCCCGCTGCTGGGTGGCAGG - Intergenic
1128124718 15:65184451-65184473 CTCTCCCGCCGCTGTCCTGCGGG + Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1129826927 15:78640562-78640584 CTCTACCACCGCTGTGTGGGAGG + Intronic
1131257638 15:90872270-90872292 CTGTGCCCCCGCTGTGTGGCTGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133288231 16:4701201-4701223 CTCTCAAGCCCCTGTGTGGCGGG - Intronic
1133945920 16:10348460-10348482 CACTGCAGCCGCTGCGTGCCAGG + Intronic
1141750949 16:85957477-85957499 CCCACCCACCGCTGCTTGGCTGG + Intergenic
1141828420 16:86496557-86496579 CTCTCCCGCTGCTGCAAGTCGGG + Intergenic
1143597295 17:7922995-7923017 GGCTCCGGCCGCTGCGTGGAGGG + Exonic
1144338977 17:14297500-14297522 CTGTCCCGCAGCTGCGAGGCCGG + Intergenic
1145094188 17:20009934-20009956 CGCTCCCGCCCCTTCCTGGCCGG + Intronic
1146001288 17:29132072-29132094 CCCTCCCTCGGCTGCGTGGTTGG - Intronic
1151025428 17:70671325-70671347 CTCACACACAGCTGCGTGGCTGG - Intergenic
1151370740 17:73644880-73644902 CTCCCCCGCCGCCCCGCGGCTGG - Intergenic
1153654916 18:7273715-7273737 CTCTCCCGCCACTGCTAGGCTGG - Intergenic
1154201116 18:12301597-12301619 CTCTCCTGTCCCTGCTTGGCTGG + Intergenic
1160083463 18:75753101-75753123 CACTCCAGCTGCTGCGGGGCAGG + Intergenic
1160950713 19:1665890-1665912 GTCTCCGGCCGGTCCGTGGCCGG + Intergenic
1161538047 19:4831806-4831828 CTTTCCCGGTGCTGCGGGGCAGG - Intergenic
1162722855 19:12672836-12672858 CTCTCCTGCAGCTCCGTGGATGG + Exonic
1165603366 19:37078087-37078109 CTCCCCCGCACCTGCCTGGCCGG + Intronic
1167134978 19:47610345-47610367 CTCTCCCGCGGCTCCTTGCCCGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
929074832 2:38072278-38072300 TTCTCCCGCCGCTGTCTGGCAGG - Intronic
935275694 2:101474038-101474060 CTCGCCCGCCGCAGCGCGGAGGG - Intronic
946052511 2:216875570-216875592 CTCTCCCGATGCTGGGAGGCTGG + Intergenic
947752938 2:232542135-232542157 CTCTCCCACTGCTGTCTGGCAGG - Intronic
948643019 2:239387349-239387371 CAGTCCCGCCGCTGCGTGCCTGG + Intronic
948770751 2:240250306-240250328 CTCTCCCGCCTCTACCAGGCAGG + Intergenic
1169295505 20:4393905-4393927 CTCTCCCTCAGCTGCCAGGCAGG - Intergenic
1172100913 20:32483610-32483632 CTCTCCCGCCTCCCCGTGCCCGG - Intronic
1176060169 20:63169053-63169075 CTCACCCACACCTGCGTGGCGGG + Intergenic
1176273408 20:64248274-64248296 CTCTCGCACCTCTGGGTGGCTGG - Intergenic
1180985751 22:19903160-19903182 CTCTCCTGCAGCTGCCAGGCTGG - Intronic
1182475480 22:30574478-30574500 CTCCTCCGCCTCAGCGTGGCTGG + Intronic
949588148 3:5463932-5463954 CTCTCCCTCTGCTGAGTGGGAGG + Intergenic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
954202100 3:49029499-49029521 CGCCCCCGCCGCAGCGAGGCGGG - Intergenic
954295903 3:49674371-49674393 CTCTGCCGCCGGGGCGAGGCGGG - Exonic
955108746 3:55926731-55926753 CTCTCCAGGGGCTGCCTGGCTGG - Intronic
957084867 3:75669589-75669611 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
957659475 3:83128856-83128878 CTCTCCTGCCTCTGAGTGGGTGG - Intergenic
958977241 3:100682213-100682235 CTCTCCCTCCGGTGAGCGGCTGG - Intronic
960569668 3:119173452-119173474 CTCCCCCGCCTCAGCGAGGCAGG + Intronic
961322270 3:126084100-126084122 CTTTCCCGCCGCCGCCTGGGAGG - Exonic
967168629 3:186806456-186806478 TTCGCCCGCCGTTCCGTGGCGGG - Exonic
967859671 3:194141519-194141541 CGCTCCCCCCGCGGCCTGGCAGG - Intergenic
972707292 4:41557706-41557728 CTCTCCCGACACTGCATGGAAGG + Intronic
974493409 4:62595837-62595859 CTCTGCCTCCGCTGCCAGGCAGG + Intergenic
982358096 4:154491063-154491085 CCCTCCTGCTGCTGCGCGGCCGG + Intronic
983204937 4:164902179-164902201 CTCTCTCGCCGCTCCATGCCTGG + Intergenic
983667982 4:170203800-170203822 CTTTCCCGCCACTGCCTGACAGG + Intergenic
984462900 4:180058761-180058783 CGCTCCAGCTGCAGCGTGGCGGG - Intergenic
985292750 4:188403716-188403738 CTCTCCCGCCTCTGCCTCCCAGG + Intergenic
985446103 4:190021985-190022007 CTCTGCCGGCGCGGCCTGGCTGG + Intergenic
985451279 4:190065298-190065320 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
985452270 4:190068593-190068615 CTCTGCCGTCGCGGCCTGGCTGG - Intergenic
985453254 4:190071890-190071912 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985454244 4:190075183-190075205 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985455232 4:190078476-190078498 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985456220 4:190081776-190081798 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985457204 4:190085070-190085092 CTCTGCCGGCGCGGCCTGGCTGG - Intergenic
985458191 4:190088363-190088385 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985459180 4:190091663-190091685 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
985463433 4:190174432-190174454 CTCTGCCGGCGCGGCCTGGCTGG - Exonic
986684397 5:10263323-10263345 CTGTCACGCCTCTGCGTGGAGGG + Intronic
996082262 5:119268954-119268976 CTCTCCCGCCGCTGGGCTGCGGG + Intronic
997272978 5:132557152-132557174 CTCTCCCGCTGTTGGCTGGCAGG + Exonic
999326936 5:150649594-150649616 CTCCTCCGCCGCCGCGGGGCTGG - Exonic
1000310613 5:160040699-160040721 CTCTCCAGCAGCTGGGTAGCTGG + Intronic
1002368168 5:178729421-178729443 CGTTCACGCCGCTGCGAGGCGGG + Intronic
1002385157 5:178860627-178860649 CGTTCACGCCGCTGCGAGGCGGG - Intronic
1006392168 6:33764865-33764887 CCCTCCCCCCACTGGGTGGCTGG + Intergenic
1006796939 6:36737893-36737915 CTCTCCCGCCCCTTCCAGGCAGG + Intergenic
1007644965 6:43372680-43372702 CTCTCCCGCCCCAGAGTGGCAGG + Intergenic
1012245747 6:96924375-96924397 CTCTCCGGCACCTGCGTCGCCGG - Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1017769137 6:157631610-157631632 CTCTCCCGCCCCTCCCTGTCTGG - Intronic
1024225935 7:47327040-47327062 TGCTCCCTCCTCTGCGTGGCTGG - Intronic
1033324361 7:140365135-140365157 CTCTCCTCCCACTGAGTGGCAGG + Intronic
1035361632 7:158317379-158317401 CTCTCCCTGGGCTGCGTGGGAGG + Intronic
1035663314 8:1363289-1363311 CTCTCCTGCCTCTGCCTTGCAGG + Intergenic
1035663324 8:1363341-1363363 CTCTCCTGCCTCTGCCTCGCCGG + Intergenic
1043687806 8:83109699-83109721 CTCTCCCCCCACTGCATGACAGG - Intergenic
1045638661 8:104223266-104223288 CCCTCCGGCCGCTGATTGGCGGG + Intronic
1048244174 8:132775531-132775553 CTCCCCGGCCGCTGCCTGGGCGG + Exonic
1048449772 8:134523218-134523240 CTGTCCCACGGCTGGGTGGCTGG + Intronic
1052991792 9:34522944-34522966 CGCTCCCGCCGCGGCGCGACCGG + Exonic
1053368441 9:37540881-37540903 CTTTCCCGCCGCTGCTAGACTGG + Intronic
1053869760 9:42478825-42478847 CTTTCCAGCTGCTGCATGGCGGG + Intergenic
1058417843 9:104806400-104806422 CTCTTCCTCCCCTGCCTGGCAGG + Exonic
1061039183 9:128129742-128129764 CTCTGCCTCCGCTGCCAGGCAGG - Intergenic
1062721584 9:138047058-138047080 CTCCCCCGCCACAGCCTGGCGGG - Intronic
1203736554 Un_GL000216v2:143875-143897 CTCTGCCGGCGCGGCTTGGCTGG - Intergenic
1199967619 X:152832952-152832974 CTCTCCCACCGCTGAGCAGCAGG + Intronic
1200216871 X:154371847-154371869 CCTTCCCGCCGCTGCCGGGCCGG - Intronic
1201179715 Y:11332989-11333011 CTCTCCTGGCGCGGCCTGGCTGG - Intergenic